Research Article | Open Access
Shanmugapriya Thiagarajan1, Selvaraj Stephen2, Sarangapani Kanagamuthu1, Stanley Ambroise3, Pragasam Viswanathan4, Palanivel Chinnakali5 and Rajesh Nachiappa Ganesh6
1Department of Microbiology, Indira Gandhi Government General Hospital and Postgraduate Institute, Puducherry – 605 001, India.
2Department of Microbiology, Mahatma Gandhi Medical College and Research Institute, Sri Balaji Vidyapeeth Deemed to be University, Puducherry – 607403, India.
3Department of Medicine, Indira Gandhi Government General Hospital and Postgraduate Institute, Puducherry – 605 001, India.
4School of Biosciences and Technology, Vellore Institute of Technology, Vellore – 632 014, Tamil Nadu, India.
5Department of Preventive and Social Medicine, Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry – 605006, India.
6Department of Pathology, Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry – 605 006, India.
J Pure Appl Microbiol. 2021;15(4):2085-2097 | Article Number: 7199
https://doi.org/10.22207/JPAM.15.4.31 | © The Author(s). 2021
Received: 26/07/2021 | Accepted: 06/09/2021 | Published: 29/09/2021
Abstract

Urinary tract infection (UTI) causes significant renal damage and disease severity is compounded by antimicrobial resistance (AMR) and other comorbidities in the patient. Blood group antigens secreted in body fluids (secretor status) are known to play a role in bacterial adhesion and we studied its influence on AMR in UTI. A total of 2758 patients with UTI were studied with urine culture, qualitative and semiquantitative urine microscopy, serum creatinine and secretor status in saliva samples by adsorption-inhibition method. Of these, AMR from 300 patients with E. coli infection were assessed as per CLSI 2019 guidelines and extended-spectrum beta-lactamase (ESBL) genes (bla TEM, bla CTX-M, bla SHV) and NDM1 genes were studied using TaqMan probes in Real-time polymerase chain reaction. Patients with UTI were followed up for two weeks. Female patients had higher predilection (57%) for E. coli infection while patients with diabetes or non-secretors had none. In our study, ESBL producers were seen in 62% of the E. coli isolates and fosfomycin had 100% susceptibility. Non-secretors were significantly associated with acute kidney injury (AKI), AMR and ESBL genes. Multidrug-resistance (MDR) was noted in 127/160 (79.4%) ESBL and 17/18 (94%) NDM1 gene encoding strains. Quantitative urine microscopy scoring predicted AKI both at presentation and at end of follow up. ESBL producers were common in our study population and non-secretors had a significant association with AMR genes. Urine microscopy scoring system may be a useful tool to predict AKI in patients with UTI.

Keywords

Antimicrobial resistance, Escherichia coli, Blood group secretor, extended-spectrum beta-lactamase, Acute Kidney Injury, Quantitative urine microscopy

Introduction

Upper urinary tract infection (UTI) remains the third most frequent infectious disease next to respiratory and gastrointestinal infections.1 Women are affected commonly and exhibit two incidence peaks during child bearing age and postmenopausal period with more than 50% of them infected with UTI at least once in their life time. UTI has a global prevalence about 150–250 million cases per year.2

E. coli is the most frequent uropathogen, followed by Klebsiella species across the globe.3-5 Increased AMR in Enterobacteriaceae restrains the therapeutic options and affects clinical outcome. The overuse of common over the counter antimicrobials is responsible for acquired microbial resistance. Development of AMR is a dynamic event and is a rapidly evolving event with regional differences based on local prescription practices and hence, periodic assessment of antibiotic susceptibility patterns is warranted to facilitate the selection of therapy.

MDR is a major public health concern where there is no reserve drug to treat the critically ill patients. MDR is defined as nonsusceptibility to at least one agent of three different classes of commonly used antimicrobial agents6. MDR is commonly seen in methicillin resistant Staphlococcus aureus (MRSA), vancomycin resistant Staphlococcus aureus, vancomycin resistant Enterococci, ESBL producing Enterobacteriaceae and metallo beta lactamases (MBL) producing bacteria.6

Increasing occurrence of AMR for beta‑lactam groups of antimicrobials is a major concern. ESBL has the ability to confer bacterial resistance to penicillin; first-, second- and third-generation cephalosporins; and aztreonam (but not the cephamycins or carbapenems) by hydrolysis of these antimicrobials, and which are inhibited by β-lactamase inhibitors such as clavulanic acid.7-10 ESBL was first identified in 1983. Within a short span of time ESBL has evolved drastically with over 300 variants being detected in different members of the family Enterobacteriaceae and other non-enteric organisms.7

New Delhi metallo-β- lactamase-1 (NDM-1), a newly described MBL has emerged as a major public health hazard as these organisms hydrolyze all β-lactams including carbapenems except monobactam.11 Following this, screening for presence of NDM mutation was done in various regions of India, Pakistan and UK, highlighting widespread dissemination of NDM1 gene.12,13 Similarly, Jamal WY et al., has reported high prevalence of NDM1 gene, where all the patients needed hospitalisation and all the isolates reporting NDM1 were MDR.14,15 This led to a situation where there were limited options to treat the deadly infection. Twenty-one NDM1 variants have been identified in different countries in a rapid pace since 2009, all of which are archived by Khan AU et al.16 The knowledge of local and regional antimicrobial susceptibility pattern is critically needed to prepare reference of the antimicrobials to be prescribed for first line therapy.

Urinary tract infection is more frequent in Diabetes mellitus due to poor metabolic control, defects in immunity and autonomic neuropathy resulting in incomplete bladder emptying, contribute in the pathogenesis of UTI.17 UTI and its resistance profile of antimicrobials were studied in patients with diabetes mellitus.

Persons with secretion of blood group antigen in body fluids are called secretors. Absence of respective antigen are called non-secretors. Non-secretor has increased inflammatory response to UTI, such as fever and higher levels of acute phase reactants such as C-reactive protein and erythrocyte sedimentation rate.18 Blood group secretor status (secretor status) predisposing to several diseases involving mucus layers such as inflammatory bowel diseases as well as other multi-system diseases such as Rheumatic fever and rheumatic heart disease.19,20 Non-secretor synthesize unique glycolipid receptor on their vaginal epithelial cells and results in increased adherence to E. coli and increased risk for recurrent UTI.21 A study from Japan interpreted association of non-secretor with female acute uncomplicated pyelonephritis caused by E. coli22 and studies from Iraq and Sudan proved that non-secretor had increased susceptibility to UTI in women and children with a greater tendency for adverse symptoms.23,24 These indicate that the expression of Fut2 gene coding for secretors and its various single nucleotide polymorphisms (SNPs), play a pivotal role in protecting the host from infection.25 There are limited studies on the association of non-secretors which have crucial effect on the adhesion of E. coli and thereby contributing to AMR. This study was designed to aid in the understanding of the role of secretor status in UTI.

UTI commonly causes AKI and is a significant cause of morbidity and can lead to progressive renal damage in settings of MDR. Identification of renal tubular damage and AKI is a critical requirement in clinical settings for early intervention to aid in recovery and minimise damage to renal parenchyma.26,27 Quantitative urine microscopy scoring system proposed by Perazella et al., is a simple investigative tool for early assessment of renal tubular damage and AKI.28

The study was designed to find the association of secretor status with anti-microbial resistance in patients with E.coli infection and its correlation with other risk factors such as diabetes mellitus and sex of the patient. We also studied the presence and persistence of AKI in these patients on follow up.

Methodology

A prospective study was conducted from June 2017 to June, 2019 in the Department of Microbiology in a tertiary care hospital in South India. A total of 2758 patients with clinical manifestations of upper UTI from both outpatients as well as those admitted in Departments of Medicine and Urology were studied.

Diagnosis
The diagnosis of UTI were suspected in patients with characteristic symptoms. Pathognomonic features of lower UTI are frequency, urgency, dysuria, and suprapubic pain; and while upper UTI was distinguished by presence of costovertebral angle pain/tenderness, fever, and chills, along lower urinary tract symptoms.1 All the patients underwent abdominal ultrasound and those with shrunken kidney, suggesting chronic kidney disease were excluded from the study.

Urine specimen were collected from 2758 patients with clinical manifestations of upper UTI except antenatal mothers and paediatric population. Clean-catch midstream urine and catheter aspirates were taken with aseptic precautions29, centrifuged and examined for significant pyuria (>10 WBC’s/HPF). Urine specimens were processed without delay in the Microbiology laboratory by inoculating into MacConkey and blood agar and incubated aerobically at 37°C for 24 hours for semi-quantitative culture. Colony count of 105 colony forming units (CFU)/ml was defined as significant bacteriuria. Isolates with CFU ≥ 105 was processed for further study. Bacterial identification was done by standard biochemical test30 and present study deals with AMR of the most predominant uropathogen.

Qualitative and semi-quantitative Scoring by Urine Microscopy
Ten millilitres (ml) of urine were centrifuged at 1500 rpm for 5min, urine sediment was placed on a glass slide and coverslip was gently applied. The unstained slide was observed in light microscope under high power field (40X) and analysed for red and white blood cells, renal tubular epithelial cells (RTEC), granular cast and hyaline casts. RTEC are defined for “size variation (11 to 15 nm in diameter), shape variation (round to columnar), and a well-evident nucleus with nucleoli”. Granular casts are defined as “fine or coarse granules contained within a cast matrix, whereas hyaline casts are defined as cast matrix without cells and are colourless. Granular casts and RTEC per high-power field were recorded on the data collection sheet as present or absent and, when present, were also quantified as the number counted: one to five, six to 10, and >10 and one to five, six to 20, >20, respectively”.28 (Table 1)

Table (1):
Perazella scoring system based on number of granular cast and RTEC seen under high-power field.

Score
Description
1
RTE cells 0 and granular casts 0
2
RTE cells 0 and granular casts 1to 5 or
RTE cells 1 to 5 and granular casts 0
3
RTE cells 1 to 5 and granular casts 1 to 5 or
RTE cells 0 and granular casts 6 to 10 or
RTE cells 6 to 20 and granular casts 0

Note: Score of ≥2 represents strong predictor of Acute Kidney Injury

Uropathogenesis of E. coli was confirmed by demonstration of various phenotypic studies like mannose sensitive hemagglutination for Type 1 Fimbriae, mannose resistant hemagglutination for P Fimbriae, crystal violet method for biofilm formation, hemolysin production and serum resistance. E. coli from culture broth were studied for presence of mutant genes involved in its pathogenesis like factors associated with bacterial adhesion namely fimH, papA, iutA, and csgA, and bacterial toxicity namely hlyA, cnf1 and iss. The data is being analyzed for association of virulence factors with blood group secretor status and antibiotic resistance and is part of the larger study.

Blood Sample Collection and testing for Blood sugar
Two ml of whole blood was collected in clot activator tubes from all the study participants in fasting and 2 hours post-prandial state. Blood sugar was assessed using chemiluminescence assay by Glucose oxidase-peroxidase method and serum creatinine by modified Jaffe reaction in Beckman Coulter autoanalyzer. WHO guidelines were followed for identifying patients with diabetes mellitus. AKI was defined by “kidney disease improving global outcomes (KDIGO) 2012 guidelines”.

Secretor status assessment by adsorption-inhibition method
Saliva from the patient was collected from study participants and used for assessment of secretor status by adsorption-inhibition method.31 Secretor status assessment was repeated twice and concordant results were taken for assessment.

Antimicrobial sensitivity testing
All patients had single E. coli isolates and they were processed for antimicrobial sensitivity testing in Muller Hinton agar with the following antimicrobials which are selected by agents from different antimicrobial classes like Aminoglycosides (amikacin 30μg), Penicillin (ampicillin 10μg), Fluoroquinolones (levofloxacin 5μg, norfloxacin 10μg), Nitrofuran (nitrofurantoin 300μg), Phosphonic acids (fosfomycin 200μg), Folate pathway inhibitors (co-trimoxazole 1.25/23.75μg), Third generation cephalosporins (cefotaxime 30μg, ceftazidime 30μg, ceftriaxone 30μg), Penicillins with β-lactamase inhibitors (piperacillin-tazobactum 100/10μg), and Carbapenems (meropenem 10μg). Escherichia coli ATCC 25922 strain was used as control. Clinical and Laboratory Standards Institute (CLSI) 2019 guidelines32 was executed in interpretation of results. AMR was compared in upper UTI patients with blood group secretor in comparison with non-secretors and similarly, diabetics in comparison with non-diabetics.

Screening and confirmation of ESBL producers
E. coli isolates showing resistance to ceftazidime (30μg), cefotaxime (30μg), and aztreonam (30μg) while being susceptible to carbapenems (meropenem) were considered Potential ESBL producers. Those isolates were recruited for ESBL confirmation test by combination disk method based on CLSI 2019 guidelines.32 As defined by CLSI 2019 guidelines, “the disk used for study of ESBL production was cefotaxime and ceftazidime alone and cefotaxime and ceftazidime in combination with clavulanic acid. A ⩾ 5 mm increase in growth inhibition zone for any antimicrobial associated with clavulanic acid, in comparison with the inhibition zone of antibiotic tested alone, confirmed ESBL production” by E. coli in our study. ESBL was differentiated from Amp C-type β-lactamases, when the isolates were resistant to cephalosporins but sensitive to clavulanic acid in combination with cephalosporins and are resistant to carbapenem.7-9

Genotypic characterisation of Anti-microbial resistance
Bacteria grown overnight in MacConkey and blood agar were inoculated and further grown in LB broth. 1.6 ml of culture broth was used for DNA isolation with Qiagen bacterial DNA isolation kit QIAamp UCP Pathogen Mini kit (catalogue No. 50214) as per the manufacturer’s protocol. Isolated DNA was quantified using Qubit 2.0 fluorometer. Commercial internal control provided by Helini Biomolecules India, were used along with the samples for normalization of the DNA extraction and amplification.

Genes regulating AMR in E.coli isolates were detected using Real Time PCR (RT PCR). The genes bla CTX‑M, bla TEM, bla SHV genes and NDM1 gene associated with metallo β- lactamases were studied. TaqMan probes were sourced from Helini, Biomolecules, India for bla CTX-M, bla SHV and NDM1 genes while probe for bla TEM was sourced from Thermofisher Scientific (assay ID Ba04646128_s1) and RT PCR was performed with Applied Biosystem Quant Studio 3 instrument. All the primers and probes (Table 2) were selected from the National Centre for Biotechnology Information website (NCBI; http://www.ncbi.nlm.nih.gov) and synthesized by Helini Biomolecules, India. The primers were checked for specificity in a BLAST search available through the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Experiments are repeated thrice to check accuracy and reliability and mean Ct value of less than 30 was used to assess the presence of gene. All PCR assays were run with in-built commercial controls in each run which were run in parallel along with the samples right from isolation step. We used RT PCR for detection as we had used Taqman probes for better sensitivity and specificity of detection. Quantification was not a part of the study design. The base pair sequence mentioned in Table 2.

Table (2):
Primer and Probe sequence of genes for Real Time PCR.

No Gene Primer
1 blaTEM-70 Thermofisher Scientific assay ID Ba04646128_s1
2 blaSHV Forward CGGTCAGCGAAAAACACC
Reverse CGCAAAAAGGCAGTCAATC
probe CCGCCATTACCATGAGCGATAACAG
3 blaCTX-M Forward GACGTTAAACACCGCCATTC
Reverse GGTGGTATTGCCTTTCATCC
probe CACTTCACCTCGGGCAATGGCG
4 NDM1 Forward GTCTGGCAGCACACTTCCTA
Reverse CGCCATCCCTGACGATCAAAC
probe TCTCGACATGCCGGGTTTCGG

The sensitivity of the Taqman probes for each antimicrobial resistance gene was determined by serial dilution of the DNA elute from the culture isolates. DNA isolation was done using the QiAprep mini prep system. Overnight E. coli culture was inoculated into Luria Bertani broth and turbidity matched with 0.5 Mac Farland standards and 1.5ml of broth is used for DNA isolation. The DNA isolated was quantified using Qubit 2 fluorimeter from Thermofisher. The average quantity of DNA isolated in our study samples was 12 micrograms with DNA concentration ranging from 10 – 14 micrograms.

Ten microlitres of DNA was used for further amplification with the Taqman probe. To determine the sensitivity of the probe, we used serial dilution of the DNA elute from the culture broth as well as the reference standard in range from 1:100, 1:1000 and 1:10,000 and 1: 100,000. The standards were replicated thrice to ensure higher replicate number and to ensure the sensitivity at a lower copy number input. The R2 value for the standard curve ranged from 0.98 to 0.99.

For each RT PCR run, the threshold line was set above the background fluorescence, intersecting at the reaction curve at the beginning of its exponential phase. The RT PCR was set for 40 cycles of amplification. Ct value less than 30 was determined as the cut off for detection of antimicrobial resistance for our target genes.

Specificity was determined by comparing the results of the Taqman probe amplification of the antimicrobial resistance with ATCC E. coli 25922 and in-built commercial controls. In our assays, we did not have any false positive amplification of the genes

Statistical Analysis
Statistical interpretation of data was done by analysis with STATA software. Pearson Chi2 test was used to analyze categorical variable and p-value of less than 0.05 is interpreted as statistically significant.

RESULTS

A total of 2758 patients were studied, of whom 1711 were male and 1047 were female. Age group of patients ranged from 14-97 years. Significant bacteriuria was observed in 529 (19.2%) samples of which 427 (80.7%) were Gram negative bacilli. The most commonly isolated organism was E. coli (56.7%), followed by Klebsiella (18.1%), Enterococci (10.8%), Pseudomonas (5.8%) and Staphylococcus aureus (4.3%), other Gram-negative bacilli (2.3%) and yeasts (1.8%).

Table (3):
Demographic distribution of patients in the study with Diabetic and Secretor status.

Age group
(Years)
Total number (%)
Male number (%)
Female number (%)
Non-secretor number (%)
Secretor
number (%)
DM
number (%)
Non-DM
number (%)
14-25
22(7.3)
7(31.8)
15(68.2)
8(36.4)
14(63.6)
2(9.1)
20(90.9)
26-65
194(64.7)
82(42.3)
112(57.7)
122(62.9)
72(37.1)
73(37.6)
121(62.4)
>66
84(28)
39(46.4)
45(53.6)
53(63.1)
31(36.9)
36(42.9)
48(57.1)

Our study focused on the patients with upper UTI, caused by E. coli, who had at least two weeks follow up and 300 patients fulfilled the criteria. The distribution of age, gender and diabetes mellitus in UTI patients with E. coli infection were studied. UTI is common in females 172 (57.3%) across all age groups, while diabetics constituted 37% of the study population (Table 3). In our study population 77.5% of diabetics were non-secretors and blood group non-secretors were significantly associated with type II diabetes mellitus (p < 0.000). Diabetes mellitus (DM) was not a statistically significant predisposing factor for upper UTI in our patient population. DM was significantly associated with AKI, at presentation as well as at the end of two weeks (p = 0.001), (Table 4) while non-secretors had significant association with AKI at presentation (p < 0.000) as well as at the end of two weeks follow-up (p = 0.005). (Table 4,5)

Table (4):
Association of Diabetic and Secretor status of the patient with AKI at presentation and at 14 days follow up.

Diabetes mellitus AKI at presentation
 
Pearson Chi2
P value
AKI at 14 days follow up
 
Pearson Chi2
P value
Absent Present 0.001 Absent Present 0.001
Absent 140(73%) 49(26%) 162(85.7%) 27(14.3%)
Present 61(55%) 50(45%) 78(70.3%) 33(29.7%)
Total 201(67%) 99(33%) 240(80%) 60(20%)
Secretor status Absent Present 0.000 Absent Present 0.005
Nonsecretor 104(56.8%) 79(43.17) 137(74.9) 46(25.1)
Secretor 97(82.9%) 20(17.09) 103(88.03) 14(11.97)
Total 201(67%) 99(33%) 240(80%) 60(20%)

Table (5):
Correlation of secretor status with sex, diabetic status and AKI in patients with UTI.

Demographic and Clinical
Parameters
Non-secretor
N (%)
Secretor
N (%)
Pearson Chi2
P value
Sex 0.239
Male 83(64.8%) 45(35.2%)
female 100(58.1%) 117(41.9%)
Diabetes mellitus 0.000
Non-DM 97(51.3%) 92(48.7%)
DM 86(77.5%) 25(22.5%)
AKI 0.000
Absent 104(51.7%) 97(48.3%)
present 79(79.8%) 20(20.2%)

Urine microscopy semi-quantitative score was found to be significant in identification of AKI at the time of diagnosis and predicted persistence of AKI at 14 days follow up. (p <0.000)

Patients in the study had no history of antibiotic intake in the past 48 hours, before onset of symptoms. All the studied isolates were resistant to at least two of the tested antibiotics. Maximum resistance was found for fluoroquinolones (87%), third generation cephalosporins (68%) and cotrimoxazole (68%). Maximum sensitivity was found for fosfomycin (100%) followed by nitrofurantoin (86%), meropenem (86%) and amikacin (83%) (Table 6).

Table (6):
Antibiotic resistance pattern in UTI by E. coli n=300 and in ESBL producer.

Antimicrobials
E. coli n(%) n= 300
Resistance
ESBL producer n(%) n=160
Resistance
Ceftazidime
199 (66.3)
160 (100)
Cefotaxime
206 (68.7)
160 (100)
Ceftriaxone
206 (68.7)
160 (100)
Ampicillin
209 (69.7)
160 (100)
Piperacillin-Tazobactum
95 (31.6)
52 (32.5)
Meropenem
42 (14)
Norfloxacin
266 (88.7)
146 (91.2)
Levofloxacin
262 (87.3)
132 (82.5)
Amikacin
51 (17)
27 (16.9)
Cotrimoxazole
204 (68)
127 (79.4)
Nitrofurantoin
40 (13.3)
22 (13.7)
Fosfomycin
0 (0)
0 (0)

E. coli culture resistant to meropenem (42/300) were excluded in the ESBL confirmation test as there is a chance that AmpC beta lactamases may mislead the test and gives false positive. About 160/258 (53.3%) of E. coli isolates were identified as ESBL producers by combination disk (phenotypic) method. ESBL-producing E. coli isolates were more resistant to antimicrobials as in Table 6. MDR was noted in 127/160 (79.4%) of ESBL producers.

On correlation of AMR in E. coli with secretor status in saliva, non-secretors were found to have significant association with resistance to ampicillin (p < 0.000), third generation cephalosporins (p < 0.000). About 124/187 (66.3%) of MDR E. coli were from non-secretor patients. Diabetes mellitus in patients did not have any statistical correlation with AMR. Table 7

Table (7):
Association of Resistance to antibiotics in non-secretor and diabetic patients.

Antibiotic resistance
Non-secretors n(%)
Total N=183
Resistance
Pearson Chi2 value
(P value)
Diabetic patients n(%)
Total N=111
Resistance
Pearson Chi2 value (P value)
Ampicillin
147(80.3%)
25.2379
(
80(72.1%)
0.4824
(0.487)
Amikacin
29(15.8%)
0.4421
(0.506)
13(11.7%)
3.4921
(0.062)
Cefotaxime
145(79.2%)
24.3582
(
78(70.3%)
0.2106
(0.646)
Ceftriaxone
145(79.2%)
24.3582
(
78(70.3%)
0.2106
(0.646)
Cotrimoxazole
130(71%)
1.9906
(0.158)
77(69.4%)
0.1518
(0.697)
Fosfomycin
0
0
Nitrofurantoin
23(12.6%)
0.2377
(0.626)
10(9%)
2.8512
(0.091)
Norfloxacin
159(86.9%)
1.4818
(0.223)
98(88.3%)
0.0251
(0.874)
Meropenem
40(21.9%)
1.0123
(0.314)
25(22.5%)
0.7007
(0.403)
ESBL production
115(62.8%)
23.2722
(
62(55.9%)
0.6971
(0.706)

Molecular detection of ESBL‑producing E. coli isolates revealed high prevalence of bla CTX-M gene in 88.7% of E. coli followed by bla SHV (34.4%) and bla TEM (11.25%). The simultaneous presence of all the three ESBL were seen in 5% of the isolates. When we studied NDM1 gene, it was seen in 6% of E. coli isolates from patients with upper UTI, which reflected carbapenem resistance. Most of the isolates encoding NDM1 (15/18) coexist with bla CTX-M (Table 8). All the NDM1 positive isolates except one was found to be multi-drug resistant 94% (17/18).

Table (8):
Frequency of extended‑spectrum beta‑lactamase genes (n=160) and NDM1 gene (n=300), isolated in E. coli isolates.

Name of gene
Frequency (%)
bla CTX-M
142 (88.7)
bla TEM
18 (11.25)
bla SHV
55 (34.4)
bla TEM + bla CTX-M
18(11.25)
bla CTX-M + bla SHV
20(12.5)
bla CTX-M, bla TEM and bla SHV
8 (5)
NDM1
18 (6)
NDM1 + bla CTX-M
15(83.3)

Genotypic detection of ESBL producing E. coli isolates also revealed significant association of bla CTX-M (p < 0.000), bla TEM (p = 0.01) and NDM1 (p = 0.012) genes with non-secretors while bla SHV was not found to be significant associated with non-secretors in our study subset. (Table 8)

AMR in bacterial culture and its genotypic characterization were not significantly associated with AKI in our study.

DISCUSSION

UTI is a significant cause for AKI thereby leading to morbidity and AMR is a constant threat to severe and persistent AKI. AMR is also constantly evolving due to differences in prescription practice, patient’s co-morbidities and disease manifestations in different clinical settings. Secretor status is known to influence bacterial adhesion and we found that non-secretors had strong association with AKI and diabetes mellitus in UTI patients. Semi-quantitative urine microscopy scoring was useful in identification of AKI and is a potentially inexpensive tool, meriting further study.

The study attempts to address the deficiency on the association of secretors with UTI and AKI. We studied the AMR in urine culture and presence of genes associated with the resistance properties and correlated the same with AKI and secretor status. This study highlights the significant association of non-secretors with AMR.

A study from Egypt shows low resistance to quinolones and this may be due variations in prescription and resistance pattern.33 In our study, fluroquinolones show maximum resistance followed by cephalosporins and cotrimoxazole which was similar to other studies.4,34

Though there is significant discrepancy in relative distribution of ESBL producing Enterobacteriaceae among different regions in the world, there has been an overall exponential increase recently adding a tremendous risk of patients with UTI who do not respond to treatment.

Several studies from India have reported 60-80% ESBL production of E. coli in UTI.35-38 Whereas in a multicentric study conducted across various regions of India by Gautham V et al.39 found ESBL production in about 35% of study population. Studies across the globe showed distribution of ESBL prevalence from 8% to 62% due to varying prescription practices.40-42 Our study reports a higher level of ESBL production of about 62%.

Increase in ESBL producing E. coli as a cause of UTI is attributed to several factors such as antibiotic policy and multiple other risk factors including common infections in different geographic areas and hospitalization for various indications.3 Also, there are various risk factors acquired from community conferring the risk factor for bla CTX-M production in this subset.43,44

In early 1960s the plasmid-mediated β-lactamase was first described in Gram-negative bacteria and named TEM 1, followed by SHV-2 enzyme which was capable of hydrolysing these antibiotics in Germany.45,46 An enzyme which hydrolyses Cefotaxime was identified and named CTX-M47 and since 2000, this is predominant in different settings like Republic of Korea48 and Morocco49 having surmounted other ESBL enzymes viz., TEM and SHV having around 40 CTX-M subtypes.7 Studies conducted in different parts of India also reported a high prevalence of CTX-M-type ESBL3,50,51, which was reflected in the findings of present study and referred this current explosive spread of CTX-M as “CTX-M pandemic”.52

In our study bla CTX-M gene was detected in 88.7% followed by bla SHV and bla TEM and the findings are comparable with Canton R et al.53, but not in agreement with the results of studies by Hassuna NA et al.33, Gautham V et al.39, Bajpai T et al.54, Jena J et al.55 as bla TEM gene was the predominant one. However, the combination of ESBL genes differed in studies between study centres. High prevalence of coexistence of two genes bla CTX-M and bla TEM was reported by Hassuna NA et al.33 and Kammili N et al.36 which corelates with our results whereas Al-Jamei SA et al.42 reported higher prevalence in combination of bla CTX-M and bla SHV. This highlights the emerging complexity of antibacterial resistance in different regions of the world and warrants further studies.

In present study, maximum sensitivity was found for fosfomycin followed by nitrofurantoin, meropenem and amikacin. Fosfomycin and nitrofurantoin were the oral antimicrobials with broad spectrum of activity. In 2011 Infectious Diseases Society of America (IDSA) established guidelines for use of nitrofurantoin and fosfomycin (single-dose) as first-line treatment for uncomplicated UTI56. Several studies in India have reported around 95% sensitivity for Fosfomycin and also reported its utility in MDR E. coli.5,37,38,57 Studies across different countries shows nearly 85–100% susceptibility to fosfomycin and minimal propensity for collateral damage.14,40,41,58 In our series, we found 100% sensitivity for fosfomycin due to this drug not being in common therapeutic use.

Previously, nitrofurantoin and amikacin were thought to be contraindicated in renal impairment. But recently risk-benefit analysis recommends cautious, short-term use in mild renal impairment patients, if there are no alternative antimicrobials in MDR settings.59-61 Amladi AU et al., shows only 56% sensitivity to nitrofurantoin14 whereas in our study, it shows 87% sensitivity highlighting that it can be a reserve drug when other drugs are resistant for the organism.

Patients with diabetes mellitus did not show any statistical association with AMR in our study and the results were similar to findings by Meiland R et al.62 Ghenghhesh KS et al.63 However, Malmartel A reported increased AMR in UTI patients with diabetes mellitus.64

We found significant association of AMR with non-secretors, particularly with beta lactam group of antimicrobials and with ESBL producers and related genes. Non-secretors are thus found to be vulnerable for antimicrobial resistance. In our study, non-secretors had higher predisposition of upper UTI infection with E. coli. These findings correlated with the findings from Stapleton21 and Dahash SL23 where they had found correlation with persistence and recurrence of UTI due to E. coli. Our study highlights that non-secretor were at higher risk of antibiotic resistance in E. coli. Similar observations have been found for non-secretors in association with antibiotic susceptibility.25,65-66 We did not find much cross-reference linking AMR and AKI, with blood group secretor status. This is an important observation requiring further study in a larger subset. AMR leading to AKI significantly increases the cost of treatment at every level from investigation workup required, need and duration of hospitalization and need for multiple different groups of medications with follow up visits due to frequent recurrences and visceral damage due to resistant organisms.67

Diabetes mellitus was associated with AKI in our study and other groups have found similar results.21 Semi-quantitative urine microscopy has been studied by other authors from different geographic settings to assess AKI and our study results are similar in detection and prediction of persistence of AKI in the first two weeks.68

In our study, we did not study the single nucleotide polymorphisms (SNPs) associated with blood group secretor status, as studied by many of the recent studies due to the possibility of variations in the SNPs in different populations. However, this is a limitation in our study as we have studied only the phenotypic expression of blood group antigens in saliva and this needs to be explored further to understand the pathogenesis of increased risk for AMR among non-secretors. Lack of long-term clinical follow-up in our study is another major limitation, as we could follow up the patients only for an average of two weeks from the time of diagnosis.

To conclude, we studied patients with upper UTI due to E. coli in a tertiary care institution for AMR along with risk factors. Women were at a higher risk of upper UTI across all age groups. Fluoroquinolones, third generation cephalosporins, and cotrimoxazole had maximum resistance while older antibiotics such as fosfomycin, nitrofurantoin, meropenem and amikacin had maximum sensitivity to E. coli. With increasing resistance against the current treatment options, older drugs may emerge as effective options. We also detected higher sensitivity to yesteryear antibiotics such as fosfomycin. We did not find any association of AMR with diabetes mellitus but non-secretor assessed by phenotypic method was found to be significantly associated with resistance to beta lactam antibiotics as well as with ESBL producers and AKI.

Declarations

ACKNOWLEDGMENTS
Authors sincerely thank Dr. V. Radhika, Head of the Department of Pathology of our Institute for help in the study of blood group secretor status in our study participants as well as in the study of haemogram and peripheral smear study. Technical staff in the Department of Microbiology, Ms. N. Mohana and Ms. Mahalakshmi sincerely contributed in the preparation and maintenance of bacterial culture for the study.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.

FUNDING
None.

ETHICS STATEMENT
The study protocol was approved by the Institute Ethical Committee (No.GHEIC/2016 dated 22/12/2016) of Indira Gandhi Government General Hospital and Postgraduate Institute – 605001. Informed written consent was received from all the participants.

AVAILABILITY OF DATA
The datasets generated and analysed during the current study are available from the corresponding author on reasonable request.

References
  1. Najar MS, Saldanha CL, Banday KA. Approach to urinary tract infections. Indian J Nephrol. 2009;19(4):129-139.
    Crossref
  2. Hrbacek J, Cermak P, Zachoval R. Current antibiotic resistance trends of uropathogens in Central Europe: Survey from a Tertiary hospital urology department 2011-2019. Antibiotics. 2020;9(9):630.
    Crossref
  3. Nisha KV, Veena SA, Rathika SD, Vijaya SM, Avinash SK. Antimicrobial susceptibility, risk factors and prevalence of bla cefotaximase, temoneira, and sulfhydryl variable genes among Escherichia coli in community-acquired pediatric urinary tract infection. Journal Lab Physicians. 2017;9:156-162.
    Crossref
  4. Pardeshi P. Prevalence of urinary tract infections and current scenario of antibiotic susceptibility pattern of bacteria causing UTI. Indian J Microbiol Res. 2018;5(3):334-338.
    Crossref
  5. Maraki S, Samonis G, Rafailidis PI, Vouloumanou EK, Mavromanolakis E, Falagas ME. Susceptibility of urinary tract bacteria to fosfomycin. Antimicrob Agents Chemother. 2009;53(10):4508-4510.
    Crossref
  6. Magiorakos AP, Srinivasan A, Carey RT, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-281.
    Crossref
  7. Rawat D, Nair D. Extended-spectrum β-lactamases in Gram Negative Bacteria. J Glob Infect Dis. 2010;2(3):263-274.
    Crossref
  8. Bush K, Jacoby GA. Updated functional classification of β-lactamases. Antimicrob Agents Chemother. 2010;54(3):969-976.
    Crossref
  9. Tekele SG, Teklu DS, Tullu KD, Birru SK, Legese MH. Extended-spectrum Betalactamase and AmpC beta-lactamases producing gram negative bacilli isolated from clinical specimens at International Clinical Laboratories, Addis Ababa, Ethiopia. PLoS ONE. 2020;15(11):e0241984.
    Crossref
  10. Adamus-Bialek W, Baraniak A, Wawszczak, M, et al. The genetic background of antibiotic resistance among clinical uropathogenic Escherichia coli strains. Mol Biol Rep. 2018;45:1055-1065.
    Crossref
  11. Yong D, Toleman MA, Giske CG, et al. Characterization of a new metallo-β-lactamase gene, bla NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046-5054.
    Crossref
  12. Kumarasamy KK, Toleman MA, Walsh TR, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597-602.
    Crossref
  13. Poirel L, Hombrouck-Alet C, Freneaux C, Bernabeu S, Nordmann P. Global spread of New Delhi metallo-β-lactamase 1. Lancet Infect Dis. 2010;10(12):P832.
    Crossref
  14. Amladi AU, Abirami B, Devi SM, et al. Susceptibility profile, resistance mechanisms & efficacy ratios of fosfomycin, nitrofurantoin & colistin for carbapenem-resistant Enterobacteriaceae causing urinary tract infections. Indian J Med Res. 2019;149(2):185-191.
    Crossref
  15. Jamal WY, Albert MJ, Rotimi VO. High prevalence of New Delhi metallo-β-lactamase-1 (NDM-1) producers among carbapenem-resistant Enterobacteriaceae in Kuwait. PLoS one. 2016;11(3):e0152638.
    Crossref
  16. Khan AU, Maryam L, Zarrilli R. Structure, genetics and worldwide spread of New Delhi metallo-β-lactamase (NDM): a threat to public health. BMC Microbiol. 2017;17:101.
    Crossref
  17. Nitzan O, Elias M, Chazan B, Saliba W. Urinary tract infections in patients with type 2 diabetes mellitus: review of prevalence, diagnosis, and management. Diabetes Metab Syndr Obes. 2015;8:129-136.
    Crossref
  18. Lomberg H, Jodal U, Leffler H, De Man P, Svanborg C. Blood group non-secretors have an increased inflammatory response to urinary tract infection. Scand J Infect Dis. 1992;24(1):77-83.
    Crossref
  19. McGovern DP, Jones MR, Taylor KD, et al. Fucosyltransferase 2 (FUT2) non-secretor status is associated with Crohn’s disease. Hum Mol Genet. 2010;19(17):3468-3476.
    Crossref
  20. Abegaz SB. Human ABO Blood Groups and Their Associations with Different Diseases. Biomed Res Int. 2021;2021:6629060.
    Crossref
  21. Stapleton A, Nudelman E, Clausen H, Hakomori SI, Stamm WE. Binding of uropathogenic Escherichia coli R45 to glycolipids extracted from vaginal epithelial cells is dependent on histo-blood group secretor status. J Clin Investig. 1992;90(3):965-972.
    Crossref
  22. Ishitoya S, Yamamoto S, Mitsumori K, Ogawa O, Terai A. Non-secretor status is associated with female acute uncomplicated pyelonephritis. BJU Int. 2002;89(9):851-854.
    Crossref
  23. Dahash SL, Al-Kuraishi AH, Al-Amir ZA. Presence of ABO Antigens of Blood Types in Saliva of Women with Urinary Tract Infection. Indian J Public Health Res Dev. 2018;9:468-474.
    Crossref
  24. Ibrahim MA, Bolad AK, Nasr NB. ABO Blood Group and Susceptibility to Urinary Tract Infection in Children. [dissertation] Al-Neelain Medical Research center: Al-Neelain University, Sudan. 2013.
    Crossref
  25. Galeev A, Suwandi A, Cepic A, Basu M, Baines JF, Grassl GA. The role of the blood group-related glycosyltransferases FUT2 and B4GALNT2 in susceptibility to infectious disease. Int J Med Microbiol. 2021;311(3):151487.
    Crossref
  26. Chawla LS, Eggers PW, Star RA, Kimmel PL. Acute kidney injury and chronic kidney disease as interconnected syndromes. N Engl J Med. 2014;371:58-66.
    Crossref
  27. Hsiao CY, Yang HY, Hsiao MC, Hung PH, Wang MC. Risk factors for development of acute kidney injury in patients with urinary tract infection. PLoS one. 2015;10(7):e0133835.
    Crossref
  28. Perazella MA, Coca SG, Kanbay M, Brewster UC, Parikh CR. Diagnostic value of urine microscopy for differential diagnosis of acute kidney injury in hospitalized patients. Clin J Am Soc Nephrol. 2008;3(6):1615-1619.
    Crossref
  29. Colle JG, Marr W. Specimen collection, culture containers and media. In: Colle JG, Fraser AG, Marmon BP, Simmons A (eds.) “Mackie and McCartney Practical Medical Microbiology”, 14th ed., Churchill Livingstone, New York; 1996:95-111.
  30. Colle JG, Miles RB, Watt B: Tests for identification of bacteria. In: Colle JG, Fraser AG, Marmon BP, Simmons A (eds): “Mackie and McCartney Practical Medical Microbiology”, 14th ed., Churchill Livingstone, New York, 1996:131-149.
  31. Thiagarajan S, Stephen S, Kanagamuthu S, et al. Does Secretor Status of ABO Blood Group in Saliva Influence the Risk of Hypertension and Urinary Tract Infection in Diabetic Patients ? J Med Sci Clin Res 2019;7(5):153-162.
    Crossref
  32. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 29th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2019.
  33. Hassuna NA, Khairalla AS, Farahat EM, Hammad AM, Abdel-Fattah M. Molecular characterization of Extended-spectrum β lactamase-producing E. coli recovered from community-acquired urinary tract infections in Upper Egypt. Sci Rep. 2020;10:2772.
    Crossref
  34. Akram M, Shahid M, Khan AU. Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in JNMC Hospital Aligarh, India. Ann Clin Microbiol Antimicrob. 2007;6:4.
    Crossref
  35. Veeraraghavan B, Jesudason MR, Prakasah JA, et al. Anti-microbial susceptibility profiles of Gram-negative bacteria causing infections collected across India during 2014-2016: Study for monitoring antimicrobial resistance trend report. Indian J Med Microbiol 2018;36(1):32-36.
    Crossref
  36. Kammili N, Rani M, Styczynski A, et al. Plasmid-mediated antibiotic resistance among uropathogens in primigravid women-Hyderabad, India. PLoS ONE. 2020;15(5):e0232710.
    Crossref
  37. Banerjee S, Sengupta M, Sarker TK. Fosfomycin susceptibility among multidrug-resistant, extended-spectrum beta-lactamase-producing, carbapenem-resistant uropathogens. Indian J Urol. 2017;33(2):149-154.
    Crossref
  38. Sabharwal ER, Sharma R. Fosfomycin: an alternative therapy for the treatment of UTI amidst escalating antimicrobial resistance. J Clin Diagnostic Res. 2015;9(2):DC06-DC09.
    Crossref
  39. Gautam V, Thakur A, Sharma M, et al. Molecular characterization of extended-spectrum β-lactamases among clinical isolates of Escherichia coli & Klebsiella pneumoniae: a multi-centric study from tertiary care hospitals in India. Indian J Med Res. 2019;149(2):208-215.
    Crossref
  40. Ny S, Edquist P, Dumpis U, et al. Anti-microbial resistance of Escherichia coli isolates from outpatient urinary tract infections in women in six European countries including Russia. J Glob Antimicrob Resist. 2019;17:25-34.
    Crossref
  41. Matthews PC, Barrett LK, Warren S, et al. Oral fosfomycin for treatment of urinary tract infection: a retrospective cohort study. BMC Infect. 2016;16:556.
    Crossref
  42. Al-Jamei SA, Albsoul AY, Bakri FG, Al-Bakri AG. Extended-spectrum β-lactamase producing E. coli in urinary tract infections: A two-center, cross-sectional study of prevalence, genotypes and risk factors in Amman, Jordan. J Infect Public Health. 2019;12(1):21-25.
    Crossref
  43. Doi Y, Adams J, O’Keefe A, Quereshi Z, Ewan L Paterson DL. Community-acquired Extended-Spectrum β-Lactamase Producers, United States. Emerg Infect Dis. 2007;13(7):1121-1123.
    Crossref
  44. Pitout JDD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing extended-spectrum β-lactamases (ESBLs) in the community. Journal of Antimicrobial Chemotherapy. 2005;56:52-59.
    Crossref
  45. Datta N, Kontomichalou P. Penicillinase synthesis controlled by infectious R factors in Enterobacteriaceae. Nature. 1965;208:239-241.
    Crossref
  46. Kliebe C, Nies BA, Meyer JF, Tolxdorff-Neutzling RM, Wiedemann B. Evolution of plasmid-coded resistance to broad-spectrum cephalosporins. Antimicrob Agents Chemother. 1985;28(2):302-307.
    Crossref
  47. Bauernfeind A, Schweighart S, Grimm H. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection. 1990;18:294-298.
    Crossref
  48. Kang C-I, Wi YM, Lee MY, et al. Epidemiology and risk factors of community onset infections caused by extended-spectrum β-lactamase-producing Escherichia coli strains. J Clin Microbiol. 2012;50(2):312-317.
    Crossref
  49. Bourjilat F, Bouchrif B, Dersi N, Claude JD, Amarouch H, Timinouni M. Emergence of extended-spectrum beta-lactamases-producing Escherichia coli in community-acquired urinary infections in Casablanca, Morocco. J Infect Dev Ctries. 2011;5(12):850-855.
    Crossref
  50. Nandagopal B, Sankar S, Sagadevan K, et al. Frequency of extended spectrum β-lactamase producing urinary isolates of Gram-negative bacilli among patients seen in a multispecialty hospital in Vellore district, India. Indian J Med Microbiol. 2015;33(2):282-285.
    Crossref
  51. Devi LS, Broor S, Rautela RS, Grover SS, Chakravarti A, Chattopadhya D. Increasing prevalence of Escherichia coli and Klebsiella pneumoniae producing CTX-M-type extended-spectrum beta-lactamase, carbapenemase, and NDM-1 in patients from a rural community with community acquired infections: A 3 years study. Int J App Basic Med Res. 2020;10(3):156-163.
    Crossref
  52. Canton R, Coque TM. The CTX-M β-lactamase pandemic. Curr Opin Microbiol. 2006;9(5):466-475.
    Crossref
  53. Canton R, Novais A, Valverde A, et al. Prevalence and spread of extended-spectrum β-lactamase-producing Enterobacteriaceae in Europe. Clin Microbiol Infect. 2008;14(Suppl. 1):144-153.
    Crossref
  54. Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Clin Med. 2017;07(01):12-16.
    Crossref
  55. Jena J, Sahoo RK, Debata NK, Subudhi E. Prevalence of TEM, SHV, and CTX-M genes of extended-spectrum β-lactamase-producing Escherichia coli strains isolated from urinary tract infections in adults. 3Biotech. 2017;7:244.
    Crossref
  56. Gupta K, Hooton TM, Naber KG, et al. International clinical practice guidelines for the treatment of acute uncomplicated cystitis and pyelonephritis in women: A 2010 update by the Infectious Diseases Society of America and the European Society for Microbiology and Infectious Diseases. Clin Infect Dis. 2011;52(5):e103-120.
    Crossref
  57. Sreenivasan S, Kali A, Charles MP, Kunigal S. Evaluation of in vitro susceptibility of fosfomycin among Enterobacteriaceae isolates from urine cultures: A study from Puducherry. Journal Lab Physicians. 2019;11(03):249-252.
    Crossref
  58. Fajfr M, Louda M, Paterova P, et al. The susceptibility to fosfomycin of Gram-negative bacteria isolates from urinary tract infection in the Czech Republic: data from a unicentric study. BMC Urol. 2017;17:33.
    Crossref
  59. Ahmed H, Farewell D, Francis NA, Paranjothy S, Butler CC. Risk of adverse outcomes following urinary tract infection in older people with renal impairment: Retrospective cohort study using linked health record data. PLoS Medicine. 2018;15(9):e1002652.
    Crossref
  60. Singh N, Gandhi S, McArthur E, et al. Kidney function and the use of nitrofurantoin to treat urinary tract infections in older women. Cmaj. 2015;187(9):648-656.
    Crossref
  61. Hanberger H, Edlund C, Furebring M, et al. Rational use of aminoglycosides-review and recommendations by the Swedish Reference Group for Antibiotics (SRGA). Scand J Infect Dis. 2013;45(3):161-175.
    Crossref
  62. Meiland R, Geerlings SE, De Neeling AJ, Hoepelman AI. Diabetes mellitus in itself is not a risk factor for antibiotic resistance in Escherichia coli isolated from patients with bacteriuria. Diabet Med. 2004;21(9):1032-1034.
    Crossref
  63. Ghenghesh KS, Elkateb E, Berbash N, et al. Uropathogens from diabetic patients in Libya: virulence factors and phylogenetic groups of Escherichia coli isolates. J Med Microbiol. 2009;58(8):1006-1014.
    Crossref
  64. Malmartel A, Ghasarossian C. Bacterial resistance in urinary tract infections in patients with diabetes matched with patients without diabetes. J Diabetes Complicat. 2016;30(4):705-709.
    Crossref
  65. Mottram L, Wiklund G, Larson G, Qadri F, Svennerholm AM. FUT2 non-secretor status is associated with altered susceptibility to symptomatic enterotoxigenic Escherichia coli infection in Bangladeshis. Sci Rep. 2017;7:10649.
    Crossref
  66. Wu Z, Feng H, Cao Y, et al. New insight into the molecular mechanism of the FUT2 regulating Escherichia Coli F18 resistance in weaned piglets. Int J Mol Sci. 2018;19(11):3301.
    Crossref
  67. Alam MF, Cohen D, Butler C, et al. The additional costs of antibiotics and re-consultations for antibiotic-resistant Escherichia coli urinary tract infections managed in general practice. Int J Antimicrob Agents. 2009;33(3):255-257.
    Crossref
  68. Kana S, Ganesh RN, Surendran D, Kulkarni RG, Bobbili RK, Jeby JO. Urine microscopy and neutrophil lymphocyte ratio are early predictors of acute kidney injury in patients with urinary tract infection. Asian J Urol. 2020;8(2):220-226.
    Crossref

Article Metrics

Article View: 5811

Share This Article

© The Author(s) 2021. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.