ISSN: 0973-7510
E-ISSN: 2581-690X
and Karuppannan Sathiyamurthy Ready-to-eat food products procured from different roadside shops in Tiruchirappalli, Tamil Nadu were screened for Escherichia coli. A total of 500 samples from 250 vegetable and 250 meat products were collected from different hotels, restaurants and street food vendors in Tiruchirappalli, Tamilnadu. Out of 500 ready-to-eat food samples, 162 (32.4%) E. coli strains were isolated. The ready-to-eat meat products had higher bacterial count than the vegetable food samples collected due to unhygienic handling, improper storage, inadequate temperature to maintain processed meat and improper cooking. Biochemically identified E. coli colonies were screened for housekeeping gene uidA and 139 (85.8%) E. coli isolates were confirmed to possess β-glucuronidase activity. In addition, antibiotic susceptibility assay was performed using 12 antibiotics. From 139 E. coli strains, 96 (69.1%) isolates showed multidrug resistance. Among them, 16.7% showed 100% resistance to all the antibiotics tested. Whereas, multidrug resistant E. coli isolates showed increased resistance (75.9%) to streptomycin followed by 70-50% level of resistance to ceftriaxone, ampicillin, cefixime, ciprofloxacin, tetracycline, gentamicin, doxycycline, co-trimoxazole, norfloxacin, ofloxacin and chloramphenicol. Furthermore, drug resistant E. coli isolates 56 (58.3%) were detected with the presence of intI1. The source of contamination was found to be water and human handling. Drinking water supply from corporation might have been contaminated with fecal waste source is being discharged into Cauvery river which might disseminate horizontal gene transfer.
Ready-to-eat, E. coli, uidA gene, Multidrug resistance, Class 1 integron, Public health
The World Health Organization (2014), on antimicrobial resistance surveillance, reported that Echerichia coli is one among the nine bacteria responsible for common infections in the community1. Bacterial evolution enables their adaptation to mostf the ecosystems2. It is suspected that mortalities due to multidrug resistance will ncrease to 10 million by 2050 and in that, E. coli infection’s contribution will be 30%3. E. coli is a significant member of intestinal non-pathogenic bacteria, which may possess antibiotic drug resistance4. E. coli is the highly potential reservoir and carrier of resistant plasmids5. Antibiotic resistant genes encoded with integrons are regarded as genetic pollutants6.
Integrons are mobile genetic elements with plasmids and transposons catalyzed by integrase recombination which promote dissemination of antimicrobial resistant gene among Enterobacteriaceae. E. coli involve insertion sequence mechanisms which are unique to mobilize a wide range of antimicrobial resistant genes7. Integrons encoding antibiotic resistance present in E. coli has a tendency to stockpile multidrug resistance via horizontal gene transfer8. The presence of mobile integrons, multidrug resistant plasmids and class 1 integron play a major role in spreading of resistant gene in fresh produce and animal foods. E. coli can be transferred to human through ready-to-eat foods that are easily contaminated during and post-processing, storage and easily spread resistance genes to other pathogens9. E. coli is an active reservoir of integrons which transfer antibiotic resistant genes of different classes of antibiotics including aminoglycoside, fluroquinolones, cephalosporins, tetracycline, phenicols, and sulfonamides through water and food chain10. The multidrug resistant non-pathogenic E. coli mobilizes the resistant gene through food, water and soil.
Mutation contributes bacterial adaptation and horizontal gene transfer that occurs much in the environment11. The food and water bodies are regarded as a vehicle for dissemination of antibiotic resistant genes among human bacterial pathogens due to non-selective use of antimicrobials12. A better understanding of dissemination of antibiotic resistant gene into the human microbiome through food is essential to prevent multidrug resistant infections13. The spontaneous process of resistance in commensal E. coli makes as fitness genes and adapted the commensal E. coli to disseminate antibiotic resistance genes14. Antibiotic resistance among pathogenic and non-pathogenic bacteria is a global threat. The present study was undertaken to study the antibiotic resistance and to detect the class 1 integron among non-pathogenic E. coli from different ready-to-eat foods obtained in Tiruchirappalli, Tamil Nadu.
The isolation and identification of E. coli was carried out as per The United States – Food and Drug Administration, bacteriological analytical manual with some modification15.
Collection of sample
A variety of 500 different ready-to-eat food samples such as vegetable (n=250), meat products (n=250) were purchased from different roadside street food vendors, restaurants, hotels and fast food stalls in Tiruchirappalli, Tamilnadu. All the samples were collected in a new polythene zipper pouch and brought immediately to laboratory in an iced sample box and stored at 4°C until processing. The collected samples were subjected to bacteriological and biochemical examination within 12 h of collection.
Isolation and identification of E. coli
About 10 g of each sample was smashed uniformly in sterile mortar and pestle and mixed in 90 ml of buffered peptone broth (Himedia, Mumbai) and incubated at 37°C for 24 h as pre-enrichment. Further, enrichment was done by transferring 1 ml of pre-enriched mixture into 9 ml of lactose broth and tryptone phosphate broth (Himedia), respectively and incubated for 16±2 h at 37˚C15. A loop of enriched culture was streaked on to xylose lysine deoxycholate (XLD) agar and macConkey (MAC) agar plates and incubated at 37°C for 18±2 h16. Further screening test was performed by re-streaking on Eosin methylene blue (EMB) agar plates and incubated for 18±2 h at 37°C. Colonies with metallic green sheen with dark centered purple were sub cultured in luria agar (LA) plates and incubated for 16±2 h at 37°C. Biochemical tests were performed after isolation to confirm atypical E. coli. Pure cultures from non-selective media were tested for indole, methyl red, voges-proskauer, citrate, triple sugar iron (TSI) agar, lysine iron agar (LIA) and urea formation in test tubes and incubated for 18 h at 37°C15,16.
Molecular screening of β-glucuronidase enzyme activity
The freshly cultured E. coli isolates were grown on LA plates andre inoculated in 500µl of 1X phosphate buffer solution (PBS). The suspension was boiled for 10 min followed by 5 min snap chilling and centrifuged at 10,000 rpm for 5 min16. The supernatant was used for molecular confirmation. The oligonucleotide primers targeting uidA gene (166 bp) were used to confirm the identified E. coli isolates (Table 1). The molecular assay was carried out in a 20µl reaction mixture containing 10µl of 2X PCR master mix (Himedia) with 1µl of each forward and reverse primers (Eurofins, India), 3µl of DNA and 5µl of water16. The amplified products were run on 2% agarose gel at 70V for 40 min and stained in 0.5µg/ml of ethidium bromide for 20 min19 and visualized under UV trans-illuminator.
Table (1):
Details of PCR primer and condition used for the detection of uidA gene in E. coli.
Target gene |
Primer name |
Direction |
Sequence 5′-3′ |
Cyclic condition |
Base pairs |
Reference |
|---|---|---|---|---|---|---|
uidA |
UAL1939b UAL2105b |
Forward Reverse |
ATGGAATTTCGCCGATTTTGC ATTGTTTGCCTCCCTGCTGC |
94 °C 5 min; 35 cycles 94 °C 10s, 55.2 °C 10s, 72 °C 1 min; 72 °C 10 min |
166 |
19 |
Table (2):
The primer sequence used for the detection of class 1 integron.
Target gene |
Direction |
Sequence 5′-3′ |
Cyclic condition |
Base pairs |
Reference |
|---|---|---|---|---|---|
intI1 |
Forward Reverse |
ACGAGCGCAAGGTTTCGGT GAAAGGTCTGGTCATACATG |
94 °C 3 min; 35 cycles 94 °C 30 sec, 60 °C 30 sec, 72 °C 1 min 30 sec; 72 °C 5 min |
565 |
9 |
Antibiotic susceptibility of E. coli
Antibiotic susceptibility test was performed by Kirby-Bauer disc diffusion method on Muller Hinton Agar, as per the guidelines of Clinical and Laboratory Standards Institute17. The 24 h fresh culture of E. coli isolated from ready-to-eat food samples was streaked on to LA plates and incubated at 37°C for 16±2 h. The isolated colony was mixed in 5ml of luria bertani broth and incubated for 4 to 6 h until the appearance of moderate turbidity. Then the bacterial growth was measured by optical density (OD600) and standardized by adjusting to 1.5×108 CFU/ml by diluting the inoculum. With the sterile cotton swab, the bacterial cells were taken from the bacterial suspension and evenly swabbed on to MHA plates. The antibiotic discs (Himedia) with different concentrations used in this study are ampicillin (AMP, 10µg), ceftriaxone (CTR, 30µg), chloramphenicol (C, 30µg), ciprofloxacin (CIP, 5µg), doxycycline hydrochloride (DO, 30µg), gentamicin (GEN, 10µg), norfloxacin (NX, 10µg), ofloxacin (OF, 5µg), streptomycin (S, 300µg), tetracycline (TE, 30µg), co-trimoxazole (COT, 25µg) and cefixime (CFM, 5µg). The antibiotic discs were aseptically placed with sterile forceps in the swabbed MHA plates andncubated for 24 h at 37°C. The diameter of zone was interpreted with zone size interpretative chart with the quality control of reference strain E. coli ATCC 2592218.
Detection of integron integrase class 1 (intI1) in E. coli
The antibiotic resistant E. coli strains were investigated for class 1 integron, a genetic element which disseminate antibiotic resistance via horizontal gene transfer. Boiling template method was performed16. The suspension was centrifuged at 6000 rpm for 10 minutes to isolate plasmid DNA (Table 2). The presence of integron integrase class 1 was detected with the primers targeting 565 base pairs. The amplified mixtures were run on agarose gel electrophoresis with 1% concentration9 at 90 Volt for 25 min. After the run, bands were visualized under UV trans-illuminator.
Statistical analysis
The statistical analysis was carried out using statistical package for the social sciences (SPSS), 20.0 version. The correlation between food and class 1 integron are significant at 0.01 level.
A total of 500 food products were procured respectively from different shops in Tiruchirappalli, Tamil Nadu. Among 500 ready-to-eat food samples, 162 (32.4%) isolates were found to produce pink colonies on MAC agar plates, yellow colonies on XLD agar plates and metallic green sheen with dark purple centered colonies on EMB agar plates. Further, these suspected colonies were subjected to identification through phenotypic examination with the results of Indole-positive, Methyl Red-positive, Voges-Proskauer-negative, Citrate-negative, H2S-negative, TSI test-positive and LIA test-positive.
Table (3):
A detailed positive report of E. coli isolated from ready-to-eat food products.
Food products |
No. of samples |
No. of E. coli positive isolates |
No. of uidA positive E. coli |
Total no. of multidrug resistant isolates |
Total no. of IntI1 positive samples |
|---|---|---|---|---|---|
Vegetables |
250 |
80 |
64 |
42 |
20 |
Meat products |
250 |
82 |
75 |
54 |
36 |
Total |
500 |
162 (32.4%) |
139 (85.8%) |
96 (69.1%) |
56 (58.3%) |
Table (4):
Statistical analysis between ready-to-eat foods and class 1 integron.
Ready-to-eat food samples |
Mean |
Standard Deviation |
N |
|---|---|---|---|
E. coli isolated from vegetable and meat products |
2.1622 |
2.19233 |
500 |
Presence of intI1among vegetable and meat products |
.5405 |
.76720 |
500 |
Correlation |
Class 1 integron (intI1) |
|---|---|
E. coli isolated from ready-to-eat food samples |
.657** |
** Correlation is significant at the 0.01 level.
From among 162 isolates, uidA gene was detected in 139 (85.8%) isolates and 23 (14.2%) isolates were found to be negative for uidA gene. It was found that out of 250 vegetable ready-to-eat food samples, 80 (32%) E. coli strains were identified and 64 (80%) of them were confirmed positive for uidA gene. Among them, 16 (20%) isolates were negative. On the other hand, 82 (32.8%) E. coli isolates were identified among 250 ready-to-eat meat products and 75 (91.46%) of them were positive for uidA gene and 7 (8.53%) E. coli isolates were found to be absence of uidA gene.
Totally, 139 (vegetable = 64 and meat products = 75) E. coli isolates were analyzed for drug resistance. E. coli from both vegetable and meat products showed highest resistance against streptomycin (62.5% and 54.7%) respectively. Similarly, lower resistance was recorded against chloramphenicol in both vegetable (21.9%) and meat products (36%) respectively. In general, meat products showed higher resistance pattern than vegetable food samples except streptomycin. In meat products, other antibiotics such as ceftriaxone (54.7%), ampicillin (50.7%), cefixime (50.7%), tetracycline (46.7%), ciprofloxacin (45.3%), co-trimoxazole (45.3%), doxycycline (45.3%), norfloxacin (44%), gentamicin (42.7%), ofloxacin (41.3%) have shown higher resistance. In vegetable food samples, ampicillin (42.2%) followed by gentamicin (42.2%), ceftriaxone (40.6%), ciprofloxacin (40.6%), cefixime (40.6%), doxycycline (37.5%), tetracycline (37.5%), co-trimoxazole (34.4%), ofloxacin (31.2%) and norfloxacin (28.1%) showed higher resistance
From among 139 E. coli strains, 96 (69.1%) (vegetable = 42 and meat products = 54) isolates were found to possess multidrug resistance. The 96 E. coli isolates showed multidrug resistance against streptomycin (80.2%), ceftriaxone (67.7%), ampicillin (66.6%), cefixime (66.6%), ciprofloxacin (62.5%), tetracycline (61.4%), doxycycline (60.4%), gentamicin (60.4%), co-trimoxazole (57.3%), norfloxacin (53.1%) ofloxacin (53.1%) and chloramphenicol (42.7%). The highest sensitivity was found againsthloramphenicol (35.4%) followed by ofloxacin (33.3%), gentamicin (29.1%), co-trimoxazole (29.1%), norfloxacin (28.1%), tetracycline (22.9%), ceftriaxone (20.8%), ampicillin (18.7%), doxycycline (17.7%), cefixime (15.6%), ciprofloxacin (13.5%) and streptomycin has least susceptibility of 8.3%. Furthermore, E. coli isolated from 16 (16.7%) ready-to-eat food samples (vegetable=7 and meat products=9) have shown 100% resistance against all the antibiotics used in this study.
The presence of integron integrase class 1 (intI1) was examined among 96 multidrug resistant E. coli isolates from ready-to-eat food samples. From among 96 multidrug resistant isolates, 56 (58.3%) isolates were found to be positive for class 1 integron gene with 565 base pairs and 40 (41.7%) isolate were negative for intI1 gene. Also, this study proved a strong correlation between food and class 1 integron at 0.01 level of significance (Table 4).
In this study, 32.4% of E. coli were isolated from 500 samples and 139 (85.8%) confirmed with the presence of β-glucuronidase enzyme activity which confirms the occurrence of E. coli which indicates poor quality of the food samples. There is a high probability of cross-contamination source, deprived hygienic practices in preparation area, inappropriate temperature, shallow cooking, improper cleaning of meat, unwashed vegetables, uncleaned utensils, knives and low quality of raw materials. The isolation of E. coli collected from roadside vendors of Tiruchirappalli was substantiated by the observation of Edward et al. (2012) who have reported 100% E. coli contamination in 15 samples of already prepared pre-packaged fruits sold in port20,21. Though it is observed that the deep oil fried snacks and kebab dishes were seemed to be hot, charred and well-cooked, in reality, only the superficial layers were roasted and inner part of the meat or marinated vegetable remains uncooked. Similar detection of uidA gene were reported from E. coli isolated from various water food samples22.
The overall analysis among 139 E. coli isolates, 96 multidrug resistant E. coli isolates from meat products (n=54) showed increased resistance to streptomycin followed by ceftriaxone, ampicillin, cefixime, ciprofloxacin, tetracycline, gentamicin, doxycycline, co-trimoxazole, norfloxacin, ofloxacin and chloramphenicol. Whereas the multidrug resistant E. coli isolates from vegetable samples (n=42) showed maximum resistance against streptomycin and gentamicin followed by ampicillin, ceftriaxone, chloramphenicol, ciprofloxacin, doxycycline, norfloxacin, ofloxacin, tetracycline, co-trimoxazole and cefixime. The revelation of resistance against antibacterials in the present study was substantiated by Wistrand-Yuen et al. (2018) who have observed that E. coli became resistant towards tetracycline, cephalosporin and penicillin as a consequence of selective pressure23. The fact that the resistance to these antimicrobial agents might be due to mutation and drug efflux24 could not be ruled out.
The present study was substantiated by the observation of Lambrecht et al. (2019) that humans can be exposed to antibiotic resistant E. coli by contact with a contaminated natural environment and by inadequately cooked food through cross-contamination25. This record of multidrug resistant E. coli in 54 (56.2%) meat products in the present study coincided with the report of Jans et al. (2018) that antimicrobial resistance was prevalent in meat and seafood at retail level of > 50%26.
E. coli from ready-to-eat food samples has shown resistance towards more than one antimicrobial agents andnerated a concern for public health. In addition, 16.7% of multidrug resistant E. coli isolates have showed 100% resistance to all the twelve antibiotics. The ready-to-eat meat products showed higher resistance to E. coli. Overall, highest antibiotic resistance among 139 E. coli isolates was noticed against Streptomycin. The fact that the water source used in food processing and unhygienic handling is an indication of the possible route ofansmission of resistance since the water body receives antibiotic residues due to indiscriminate use by humans27.
Class 1 integrons are considered as most widespread of multiug resistance clinical, environment and areidenced to have activity human. A part of class 1 integron isund in chromosomes of environmental bacteria28. In the present study, the observation of 58.3% of class 1 integron from ready-to-eat food samples clearly depicts the unhygienic food preparation, sewage cross-contamination in water source and indiscriminate therapeutic use of antibiotics by human as possible sources. The class 1 integron in ready-to-eat products is more likely to have been routed from natural environment into human microbiota via water and foodborne microorganisms. The bacterial stress to various antimicrobials, non-antimicrobial agents, heavy metals used in the agriculture field in the form of fertilizer resulted in the selection of class 1 integron to acquire resistance gene. The remaining 41.7% showed negative for class 1 integron which may have other classes of integron or absence of integron integrase gene.
Possible source of contamination
The Cauvery water existing for the population through Tiruchirappalli corporation supply to individual homes and bore well connections with hand pump29. Disposal of wastewater from sewage treatment plant into Cauvery river, pollute the water. Also, the sewer pipe lines are connected nearby the corporation water lines. There is a high chances of cross-contamination through pipe lines. Hence, the domestic usage of fecal contaminated water in food processing and vessel washing purposes might be the reason to acquire multidrug resistance and horizontal gene transfer.
This study has clearly shown the prevailing microbial contamination of E. coli in street foods in Tiruchirappalli due to unhygienic practices and locations. Adequate awareness to the consumers and proper hygienic routines to the street food industry must be provided through camps. Apart from handling and cross-contamination, current conventional cooking methods are not adequate to kill heat-resistantrains of E. coli. Gradual increase of heat to certain target temperature will be lethal and kills E. coli in food. Miserably, optionsresistance is diminishing due to overuse of antibiotics. The new antimicrobial agents have been discovered. The mobile integrons are widely distributed and abundant in human ecosystem. As described above, the class 1 mobile integrons is anficient tool for bacterial adaptation. This allows the extra-intestinal pathogenic and non-pathogenic E. coli to overcome human activity to control bacterial growth. The non-pathogenic E. coli from food and water sources are the active reservoirs of multidrug resistanceeterminants transferable to human. Considering thise future use of antibiotics should be carefully managed to avoid further bacterial transformation and adaptation.
ACKNOWLEDGMENTS
We would like to thank Bharathidasan University for providing the space to carry out research work. The authors are grateful to Dr. A. Murugan, Assistant Professor, V.O.C College, Tuticorin for his assistance with correcting the manuscript.
CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.
AUTHORS’ CONTRIBUTION
Professor KS designed the work. AJ performed the experiments, generated data and wrote the manuscript. Professor KS read and approved the manuscript.
FUNDING
None.
ETHICS STATEMENT
Not applicable.
AVAILABILITY OF DATA
All the data generated during the study are included in this manuscript.
- World Health Organization. Antibiotic resistance surveillance report. 2014. https://www.who.int/drugresistance/documents/surveillancereport/en/
- Jones-Dias D, Manageiro V, Ferreira E, et al. Architecture of class 1, 2, and 3 integrons from gram negative bacteria recovered among fruits and vegetables. Front Microbiol. 2016;(7):1400.
Crossref - Reid CJ, Wyrsch ER, Chowdhury PR, et al. Porcine commensal Escherichia coli: a reservoir for class 1 integrons associated with IS26. Microbial Genomics. 2017;3(12):1-13.
Crossref - Kheiri R, Akhtari L. Antimicrobial resistance and integron gene cassette arrays in commensal Escherichia coli from human and animal sources in IRI. Gut Pathogens. 2016;8(1):40.
Crossref - Ghaly TM, Chow L, Asher AJ, Waldron LS, Gillings MR. Evolution of class 1 integrons: mobilization and dispersal via food-borne bacteria. PLoS One. 2017;12(6):e0179169.
Crossref - Oliveira-Pinto C, Diamantino C, Oliveira PL, et al. Occurrence and characterization of class 1 integrons in Escherichia coli from healthy individuals and those with urinary infection. Journal of Medical Microbiology. 2017;66(5):577-583.
Crossref - Shahreza MHS, Rahimi E, Momtaz H. Shiga-toxigenic Escherichia coli in ready-to-eat food staffs: Prevalence and distribution of putative virulence factors. Microbiology Research. 2017;8(2).
Crossref - Szmolka A, Nagy B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front Microbiol. 2013;4:258.
Crossref - Yu T, Zhang J, Jiang X, et al. Characterization and horizontal transfer of class 1 integrons in Escherichia coli isolates from cooked meat products. J Infect Dev Ctries. 2016;10(01):68-73.
Crossref - Poirel L, Madec JY, Lupo A. et al. Antimicrobial resistance in Escherichia coli. Microbiology Spectrum. 2018;6(4).
Crossref - Stalder T, Barraud O, Casellas M, Dagot C, Ploy M-C. Integron involvement in environmental spread of antibiotic resistance. Front Microbiol. 2012;3:119.
Crossref - Kaushik M, Khare N, Kumar S, Gulati P. High Prevalence of Antibiotic Resistance and Integrons in Escherichia coli Isolated from Urban River Water, India. Microbial Drug Resistance. 2019;25(3):359-370.
Crossref - Sunde M, Simonsen GS, Slettemeas JS, Bockerman I, Norstrom M. Integron, plasmid and host strain characteristics of Escherichia coli from humans and food included in the Norwegian antimicrobial resistance monitoring programs. PloS one. 2015;10(6):e0128797.
Crossref - Ma L, Li AD, Yin XL, Zhang T. The prevalence of integrons as the carrier of antibiotic resistance genes in natural and man-made environments. EnvironSci Technol. 2017;51(10):5721-5728.
Crossref - Feng P, Weagant SD, Jinneman K. BAM: diarrheagenic Escherichia coli. Silver Spring, MD: United States Food and Drug Administration. 2011.
- Dutta S, Guin S, Ghosh S. et al. Trends in the prevalence of diarrheagenic Escherichia coli among hospitalized diarrheal patients in Kolkata, India. PLoS One. 2013;8(2):e56068.
Crossref - Wayne. Clinical and Laboratory Standards Institute, Performance Standards for Antimicrobial Susceptibility Testing, 28th Ed. 2018; 38(1), PA19087 USA.
- Khan ZA, Siddiqui MF, Park S. Current and Emerging Methods of Antibiotic Susceptibility Testing. Diagnostics. 2019;9(2):49.
Crossref - Godambe LP, Bandekar J, Shashidhar R. Species specific PCR based detection of Escherichia coli from Indian foods. 3 Biotech. 2017;7(2):130.
Crossref - Edward K, Umoh E, Eze V. Microbial Quality of already prepared fruit salad sold in Port Harcourt, Nigeria. J Biol Agri Health. 2012;2(11):74-79.
- Paul TK, Roy SR, Sarkar PR, Tarafder M, Saha TK. Isolation and identification of bacteria in different street vended foods collected from selected areas of Bangladesh. Asian Australas J Food Saf Secur. 2018;2(2):65-70.
- Choi Y, Lee S, Lee H, et al. Rapid Detection of Escherichia coli in Fresh Foods Using a Combination of Enrichment and PCR Analysis. Korean J Food Sci Anim Resour. 2018;38(4):829.
- Wistrand-Yuen E, Knopp M, Hjort K, Koskiniemi S, Berg OG, Andersson DI. Evolution of high-level resistance during low-level antibiotic exposure. Nat Commun. 2018;9(1):1599.
Crossref - Spagnolo F, Rinaldi C, Sajorda DR, Dykhuizen DE. Evolution of resistance to continuously increasing streptomycin concentrations in populations of Escherichia coli. Antimicrob Agents Chemother. 2016;60(3):1336-1342.
Crossref - Lambrecht E, Van Coillie E, Van Meervenne E, Boon N, Heyndrickx M, Van de Wiele T. Commensal E. coli rapidly transfer antibiotic resistance genes to human intestinal microbiota in the Mucosal Simulator of the Human Intestinal Microbial Ecosystem (M-SHIME). Int J Food Microbiol. 2019;311:108357.
Crossref - Jans C, Sarno E, Collineau L, Meile L, Stark KD, Stephan R. Consumer exposure to antimicrobial resistant bacteria from food at Swiss retail level. Front Microbiol. 2018;9:362.
Crossref - Egbuim TC. Prevalence and Antibiogram o Food Vending in Awka. IJTSRD. 2018;3(1):1034-1042.
- Yu HS, Lee JC, Kang HY. et al. Changes in gene cassettes of class 1 integrons among Escherichia coli isolates from urine- specimens collected in Korea during the last two decades. J clin microbiol. 2003;41(12):5429-5433.
Crossref - TNUSSP. Sewage and Fecal Sludge Treatment in Tiruchirappalli City Corporation: Current Status, Proposed Plans and Recommendations for Improvement. 2018.
© The Author(s) 2020. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.