Research Article | Open Access
Fredrick Tiria1,2, Erick Odoyo3, Martin Georges3, Andrew Nyerere1 and Lillian Musila3
1Department of Medical Microbiology, Jomo Kenyatta University of Agriculture and Technology, Nairobi P.O. Box 62000-00200, Kenya.
2State Department for the Blue Economy and Maritime Affairs, Kisumu P.O. Box 1084 – 40100, Kenya.
3Kenya Medical Research Institute/United States Army Medical Research Directorate-Africa, Village Market, Nairobi P.O. Box 606-00621, Kenya.
Article Number: 8602 | © The Author(s). 2023
J Pure Appl Microbiol. 2023;17(4):2194-2204. https://doi.org/10.22207/JPAM.17.4.16
Received: 03 April 2023 | Accepted: 01 September 2023 | Published online: 01 November 2023
Issue online: December 2023
Abstract

Klebsiella pneumoniae is an opportunistic pathogen and a major cause of nosocomial infections. Phenotypic analysis of virulence and molecular typing of virulence-associated genes are powerful approaches to understanding Klebsiella pneumoniae infection biology. This study subjected 102 clinical Klebsiella pneumoniae isolates to virulence gene screening and phenotypic analysis of serum resistance, biofilm formation, and hypermucoviscosity. The virulence genes mrkD, ybtS, wcaJ, entD, and rmpA had a prevalence of 95.1%, 30.4%, 27.5%, 22.5%, and 0.98%, respectively. 54.9%, 36.3%, and 8.8% were serum resistant, intermediate, and susceptible, respectively. There was no significant correlation between the presence of mrkD, ybtS, wcaJ, entD, and rmpA genes and serum non-susceptibility. 53.9%, 22.5%, 6.9%, and 16.7% were strong, moderate, weak, and non-biofilm formers, respectively. The biofilm-forming phenotype was significantly correlated with mrkD (P= 0.000098) and ybtS (P=0.032) gene presence. In addition, 11.8 % of the isolates had the hypermucoviscous phenotype indicating hypervirulence. All of these hypervirulent isolates were positive for the mrkD gene and were significantly associated with the presence of the wcaJ gene (P = 0.000085). These results indicate a positive association between virulence genes with biofilm formation and hypervirulence. In conclusion, Klebsiella pneumoniae isolates circulating in Kenya are predominantly serum non-susceptible and biofilm formers. mrkD, ybtS, and wcaJ genes were identified as key genes influencing biofilm formation and hypervirulence and would be good targets for vaccine development to reduce the severity of Klebsiella pneumoniae infections in Kenya.

Keywords

Hypervirulence, Mucoviscosity, Klebsiella pneumoniae, Serum Resistance, Biofilm, Enterobacterales, Vaccine, Phenotype

Introduction

Klebsiella pneumoniae is a member of the Enterobacterales order and a major cause of hospital-associated infections (HAI).1 Healthy individuals can be asymptomatic carriers of K. pneumoniae in the gut, nose, and throat.2,3 Classical Klebsiella pneumoniae (cKP) strains are known to have high levels of antimicrobial resistance (AMR) genes and are the main cause of HAI.1 In contrast, hypervirulent Klebsiella pneumoniae (hvKP), associated with community-acquired infections (CAI) in immunocompetent individuals, have been shown to possess more virulence factor genes and fewer AMR genes.4 Hypervirulent Klebsiella pneumoniae strains have recently been flagged as an important pathogen causing life-threatening infections worldwide.5,6

However, recent studies have documented the emergence of hypervirulent-antimicrobial resistant strains, which can evade the innate arm of the immunity and antibiotic therapies.1,7,8 These strains have acquired multidrug resistance (MDR) genes and potent virulence genes such as rmpA, ybtS, wcaJ, entD, mrkD, and magA. These virulence genes have been associated with, but are not limited to, hypermucoviscosity, biofilm formation, serum resistance, and resistance to phage clearance. Scientists have characterized the virulence genes to understand Klebsiella pneumoniaeinfection biology and identified the critical virulence genes responsible for various virulence phenotypes. Results from such studies have led to the formulation of various Klebsiella pneumoniae vaccine candidates, although none has been approved for use.9 It remains unclear which virulence genes are common in virulent Klebsiella pneumoniae strains circulating in Kenya and could be vaccine candidates for research.

In Kenya, MDR and virulent Klebsiella pneumoniae have been identified and characterized by Muraya and colleagues in 2022.10 Findings from this study showed that most Klebsiella pneumoniae strains circulating in Kenya harbor numerous virulence and antimicrobial resistance genes.10 However, limited data exist on hypervirulent Klebsiella pneumoniae strains in Kenya. Therefore, this study aimed to screen for five major virulence factor genes, i.e., rmpA, ybtS, wcaJ, entD, and mrkD, in Klebsiella pneumoniae isolates from Kenya and, in parallel, conduct phenotypic tests of serum resistance, biofilm formation, and string test. The presence of virulence genes was correlated with virulence phenotypes in Klebsiella pneumoniae isolates to understand the genetic basis for the phenotypic expressions. This study hypothesized that serum-resistant, biofilm-forming, and hypermucoviscuous Klebsiella pneumoniae isolates possess these virulence factor genes.

Materials and Methods

Study isolates
This study utilized archived Klebsiella pneumoniae isolates obtained under an approved antimicrobial surveillance protocol (WRAIR#2089/SERU#2767). Standard microbial culture was used to isolate the bacteria causing the infection. The presumptive identity of the bacterial isolates was determined by rapid biochemical tests and gram staining and confirmed on the automated Vitek2® system (bioMיrieux, Lyon, France). These isolates were stored at -80 degrees Celsius (°C) in tryptic soy broth (TSB) with 40% glycerol.

In this study, 102 Klebsiella pneumoniae isolates from wound swabs, blood, urine, and pus specimens of patients presenting to hospital with signs and symptoms of bacterial infection were used. The isolates were obtained from June 2015 and December 2019 from eight hospitals in Nairobi, Kisii, Kisumu, Kericho, and Kilifi counties and archived.

Determination of the hypermucoviscosity Klebsiella pneumoniae (hvKP) phenotype
One hundred and two clinical Klebsiella pneumoniae isolates were retrieved from the ultra-low freezer (-80°C), subcultured on blood agar plates, and incubated at 37°C for 24 hours (h). Subsequently, the hypermucoviscosity of the isolates was established by a string test where standard bacteriological loops were used to form a viscous string. A string of ≥ 5mm indicates a positive test.11

Biofilm assay
The 102 Klebsiella pneumoniae isolates were evaluated for their ability to form biofilms using an in vitro biofilm formation assay. The bacterial isolates were grown in tryptic soy broth for 24h at 37°C, then 200µl pipetted in a 96-well plate and grown for three days. Each day, planktonic bacteria suspended in the broth were pipetted out, and TSB was added to the individual wells. After three days, planktonic bacteria were washed out using sterile phosphate-buffered saline (PBS), and the well was stained using crystal violet (2% v/v). To release the bound crystal violet dye from the biofilm, 200µl of 33% glacial acetic acid was added to the wells, and the optical density (OD) was read using a plate reader at 630 nm (A630). Three wells with sterile broth only served as a control for contamination. Klebsiella pneumoniae strain ATCC 700603 was used as a positive biofilm control, whereas E. coli strain K12 was used as the negative control. Each isolate was inoculated in triplicate, and the mean and coefficient of variation (CV) were calculated from the three OD readings. Any experiment with a CV greater than 30% was repeated. Strains were classified using the Donelli formula as strong (OD>0.204), moderate (0.102<OD<0.204), weak (0.0551<OD<0.102), and non-biofilm formers (OD≤0.055).12,13

Serum bactericidal assay
The ability of the various isolates to resist serum killing was evaluated using a modification of the traditional viable count technique.14 The Klebsiella pneumoniae isolates were sub-cultured in an enrichment broth (TSB), harvested early during the mid-log growth phase, and the concentration adjusted to 2×106 bacteria/mL of physiological saline. Twenty-five microliters of the bacterial suspension were mixed with 75µl microliters of pooled human serum from healthy blood donors in the USA (Sigma-Aldrich) at 1:3 (v/v) and incubated at 37°C. The serum was harvested. Samples of the incubating cultures were taken at different time points immediately after mixing, i.e., at time zero and after 1, 2, and 3 hours of incubation. Serial dilutions of the samples at each time point were plated on nutrient agar to determine the number of viable bacteria by colony counts. A Klebsiella pneumoniae strain ATCC 13883, resistant to serum killing and actively proliferating in non-immune serum, was used as a positive control. ATCC 13883 has also been proved experimentally to be susceptible to serum containing anti-KP antibodies 15 allowing us to investigate only the innate arm of the immune system. The average survival percentage was plotted against time to generate a killing/survival curve. Strains were classified as serum-sensitive if the viable count dropped to <1% of the initial count and serum-resistant if >90% of organisms survived after 180 minutes. Viable counts between these values were interpreted as intermediate resistance (1-90%).14

Virulence genes identification by PCR
The Klebsiella pneumoniae genomic DNA was extracted using a commercial DNA extraction kit (Zymo Research), and DNA purity and quantity were determined using the Nanodrop (ThermoFisher Scientific, Waltham, MA, USA). The virulence factor genes were detected by conventional uni- and multiplex polymerase chain reaction (PCR) on thermocyclers (SimpliAmp™ Thermal Cycler, applied biosystems). The gene targets, primers, cycle conditions, control strains, and amplicon sizes are listed in Table 1. A multiplex PCR of wcaJ, ybtS, and mrkD and the ATCC 43816 positive control was performed under the following conditions: initial denaturation 95°C for 15 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 90 s, elongation at 72°C for 60 s and final elongation at 72°C for 10 min. entD was amplified using similar PCR conditions but using Klebsiella pneumoniae strain ATCC 13883 strain as the positive control. rmpA gene was amplified under the following optimized conditions: initial denaturation at 95°C for 15 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 45°C for 90 s, elongation at 72°C for 60 s, and final elongation at 72°C for 10 min. Klebsiella pneumoniae ATCC 43816 strain was used as the positive control.

Table (1):
Sequences of the primers used in PCRs

Gene
Primer sequence (5′ to 3′)
Annealing temperature
Control strain
Amplicon size (BP)
wcaJ FP
wcaJ_RP
AAATGGCGTACCGGTTGTTC
CGGCCCTTTCGAGGTAGTTT
60
ATCC 43816
163
ybts FP
ybts RP  
GACGGAAACAGCACGGTAAA
GAGCATAATAAGGCGAAAGA
60
ATCC 43816
242
mrkD FP
mrkD RP
AAGCTATCGCTGTACTTCCGGCA
GGCGTTGGCGCTCAGATAGG
60
ATCC 43816
340
entD FP
entD RP
CACCATCGCACCGTTTTGC
TGATGATGTATTCCCCTGCCTG
60
ATCC 13883
601
rmpA FP
rmpA RP
ACTGGGCTACCTCTGCTTCA
CTTGCATGAGCCATCTTTCA
45
ATCC 43816
536

The amplicons were detected by electrophoresis on a 1.5% agarose gel alongside a 100bp DNA ladder (Invitrogen TrackIt) and detected using Safe SYBR green on a gel documentation system (Vilber Gel Documentation Systems).

Statistical analysis
The significance of differences between phenotypic characteristics of serum resistance, biofilm formation, hypermucoviscosity, and the presence of virulence genes was evaluated using the chi-square test. Microsoft Excel 2016 was used to capture raw data and perform basic data analysis. Descriptive analysis and data presentation were done using GraphPad Prism and STATA 16.

RESULTS

Bacterial isolates
Out of the 102 Klebsiella pneumoniae isolates, 77 (75.5%), 23 (22.5%), and 2 isolates (2%) had been obtained from patients with community-acquired infection, hospital acquired infections, and unclassified sources, respectively.

Serum resistance phenotype
Out of the 102 clinical Klebsiella pneumoniae isolates, 56 isolates (54.9%) were serum resistant, 37 isolates (36.3%) had intermediate resistance, whereas 9 isolates (8.8%) were serum susceptible. Figure 1 shows a representative growth pattern for each of these resistance profiles. The positive control strain (Klebsiella pneumoniae strain ATCC 13883) exhibited exponential growth after 180 minutes reaching up to three-fold the inoculum size. Serum-resistant isolates, after 180 minutes, show more than 90% survival following exposure to the innate immunity in the blood. Some serum-resistant isolates (e.g., KKP 104 and KKP 187) exhibited an exponential increase of more than two-fold after 180 minutes indicating the complete evasion of the innate immunity that mimics what happens in a natural infection.

Figure 1. The different killing curves of K. pneumoniae isolates exposed to human serum, indicating serum-resistant, intermediate, and susceptible phenotypes

Strains KKP 134 and KKP 177 exhibited an intermediate phenotype having fewer CFUs (i.e., between 1% and 90%) after 180 minutes than at the start of the experiment. This intermediate growth indicates partial growth inhibition by innate immunity. Two strains, KKP 108 and KKP 105, represent the serum susceptible phenotype in which <1% of the CFUs are present after 180 minutes. The host’s innate immunity quickly eliminates these isolates.

Quantitative biofilm assay
From the 102 clinical Klebsiella pneumoniae isolates, 55 isolates (53.9%) were strong biofilm formers (+++), 23 isolates (22.5%) were moderate biofilm formers (++), 7 isolates (6.9%) were weak biofilm formers (+) whereas 17 isolates (16.7%) were negative (-) for the biofilm-forming phenotype. The mean absorbance of strong biofilm formers (+++), moderate biofilm formers (++) and weak biofilm formers (+) was 0.71, 0.16 and 0.08 respectively. Figure 2 below illustrates the phenotypic biofilm results.

Figure 2. The proportions (%) of K. pneumoniae isolates with different biofilm formation characteristics

Hypermucoviscosity (hv-KP) assay
Of the 102 Klebsiella pneumoniae isolates screened for the hypermucoviscosity phenotype, only 12 (11.8%) were positive. Table 2 below shows the hypermucoviscous characteristics of the 12 clinical isolates positive for hypermucoviscosity.

Table (2):
Phenotypic characteristics of hypermucoviscous clinical isolates

Sample no.
Hyper-mucoviscosity
Serum bactericidal (SBA) assay result
Biofilm assay
Virulence genes
KKP 101
Positive
I
+++
mrkD, wcaJ, ybtS
KKP 104
Positive
R
+++
mrkD, rmpA, entD
KKP 138
Positive
I
+++
mrkD, wcaJ
KKP 150
Positive
I
+++
mrkD, ybtS
KKP 152
Positive
R
+++
mrkD, wcaJ, entD
KKP 173
Positive
R
++
mrkD, wcaJ
KKP 179
Positive
S
mrkD, wcaJ
KKP 194
Positive
R
+++
mrkD, wcaJ
KKP 197
Positive
R
+++
mrkD, wcaJ
KKP 198
Positive
R
+++
MrkD
KKP 201
Positive
R
++
mrkD, wcaJ
KKP 203
Positive
R
+++
mrkD, wcaJ

R – Serum resistant, I – serum intermediate, S – serum susceptible, +++ – strong biofilm former, ++ – moderate biofilm former, + – weak biofilm former, – non-biofilm former

mrkD gene was present in all hvKP isolates, while wcaJ was the second most frequently detected gene in hvKP (9/12). A statistically significant correlation was established between the wcaJ gene and the hypermucoviscous phenotype (P-value = 0.000085).

Identification of the virulence genes mrkD, ybtS, wcaJ, and entD
The results of the screening of the four key virulence genes are summarized in Figure 3. Among all clinical Klebsiella pneumoniae isolates, the mrkD gene (n=97, 95.1%) was the most prevalent, followed by ybtS (n=35, 34.3%), wcaJ (n=28, 27.5%), entD (n=23, 22.5%). The rmpA gene was the least frequent (n=1, 0.98%). The distribution of these genes amongst the various phenotypes is illustrated in Table 3 and 4.

Table (3):
Distribution of virulence genes in serum susceptible and non-susceptible clinical K. pneumoniae isolates

Virulence gene Total isolates positive Serum resistance phenotype
Susceptible (n=9) Non-susceptible (n=93) P-value
MrkD 97(95.1%) 8 89 0.37
EntD 35(34.3%) 4 31 0.50
YbtS 28(27.5%) 4 24 0.23
WcaJ 23(22.5%) 1 22 0.39
rmpA 1(0.98%) 0 1 N/A

Table (4):
Distribution of virulence genes in biofilm-forming and non-biofilm-forming clinical K. pneumoniae isolates

Virulence gene
Total isolates
Biofilm formers(n=85)
Non-biofilm formers (n=17)
p-value
mrkD
97(95.1%)
84
13
0.000098
YbtS
35(34.3%)
33
2
0.032
wcaJ
28(27.5%)
26
2
0.11
EntD
23(22.5%)
19
4
0.92
rmpA
1(0.98%)
1
0
N/A

Table (5):
Distribution of virulence genes in relation to the site of infection

Virulence gene
Skin and soft tissue infection (SSTI)
Urinary tract infection (UTI)
MrkD
98.7%
84%
EntD
24.7%
16%
YbtS
27.3%
40%
WcaJ
29.9%
20%
rmpA
1.3%
0%

Figure 3. Detection of K. pneumoniae virulence genes by PCR in representative isolates.

Agarose gel electrophoresis (1.5%) image of PCR products. Lane M1, DNA ladder (100bp); lane 1, entD negative control; lane 2 & 3 entD gene, 601 bp; lane 4 rmpA negative control; lane 5 & 6 rmpA gene, 536 bp; lane 7, mrkD negative control; lane 8 & 9 mrkD gene, 340 bp; lane 10, ybtS negative control; lane 11 & 12 ybtS gene, 242 bp; lane 13, wcaJ negative control; lane 14 & 15 wcaJ gene, 163 bp

The Klebsiella pneumoniae isolates classified as skin and soft tissue infection (SSTI) (n=77) or urinary tract infections (UTI) (n=25). The virulence genes (mrkD, entD, wcaJ and rmpA) were more prevalent in Klebsiella pneumoniae strains isolated from SSTI than in UTI. Only ybtS occurred more in UTI than in SSTI. Table 5 above illustrates the distribution of virulence factor genes in relation to the sample site the clinical K. pneumoniae strain was isolated.

DISCUSSION

This study identified key virulence factor genes (mrkD, ybtS, wcaJ, entD, and rmpA) and their association with phenotypic expressions in Klebsiella pneumoniae of serum resistance, biofilm formation, and hypervirulence. These virulence characteristics are essential in the Klebsiella pneumoniae pathogenesis since they determine the bacterium’s survival in a host post-infection. Furthermore, virulence genes are important in establishing metastatic, invasive Klebsiella pneumoniae infections within the body.16,17 entD and ybtS genes encode products that catalyze the biosynthesis of compounds key in iron acquisition from the host’s transferrin and lactoferrin, thereby promoting bacterial survival inside the host.18,19 mrkD has been linked with biofilm formation, and this is crucial in Klebsiella pneumoniae as a cause of catheter urinary tract infections by enhancing the survival in indwelling catheters.20,21 wcaJ and rmpA have been linked with bacterium mucoviscosity, and these are crucial in bacterium’s seroprotection from the hostile humoral and cellular immune components.16,20

We looked at some of the phenotypic indicators of virulence. The first was serum resistance. Serum resistance has been experimentally linked with virulence in many bacterial species.22 The bactericidal activity of serum is a nonspecific response to inhibit the growth and proliferation of infectious microorganisms. From the results, a majority of the isolates, 54.9%, were serum resistant. Serum resistance has been linked to many defense mechanisms, including producing thick capsular material and masking critical antigenic epitopes that are key targets of the host’s innate immune cells.5,22,23 These defenses make the bacterium invisible to the host immunity and able to establish an infection.22 8.8% of the isolates were susceptible to the human serum, indicating that the innate immunity in the serum of healthy individuals 11,22 could quickly clear them. Our results suggest that most Klebsiella pneumoniae strains circulating in Kenya are resistant to the bactericidal activity of non-immune human serum and can easily establish infections in immunocompetent individuals. These data could account for the high prevalence of Klebsiella pneumoniae infections in Kenya, as indicated in a study by Apondi and colleagues in 2016 that found that Klebsiella pneumoniae accounted for 23% of bacterial strains isolated in a tertiary teaching and referral hospital in Western Kenya,24 and a second study showing that 20% of total nosocomial bacteremia episodes between 2002 and 2009 at Kilifi County Hospital in Kenya were Klebsiella pneumoniae infections.25 These studies implicate Klebsiella pneumoniae as a significant cause of community-acquired and nosocomial infections in Kenya. Many studies conducted worldwide show a similar serum resistance profile; for example, Ballen et al. found that more than 50% of Klebsiella pneumoniae strains isolated from patients in a Spanish hospital were highly resistant to human serum8 while Ku and colleagues found that 69.7% Klebsiella pneumoniae isolates in a study conducted in China where serum resistant.26

The second phenotypic indicator of virulence was biofilm. Our findings indicated that 83.3% of the Klebsiella pneumoniae isolates form bacterial protective aggregates (biofilms), which can enhance virulence and exacerbate antibiotic resistance, contributing to their clinical success. A similar study by Nirwati et al., found that 85.63% of Klebsiella pneumoniae strains isolated from a hospital in Indonesia were biofilm formers.1 Seifi et al. reported that most Klebsiella pneumoniae strains (93.6%) isolated in Iran were biofilm formers, with only 6.4% negative for the phenotype.27 These results corroborate the findings from this study. Biofilm formers can persist in the environment and these bacterial communities can exchange virulence and antimicrobial resistance genes freely via horizontal gene transfer,28,29 and by plasmid conjugation.12 Biofilm-forming bacteria have been linked with nosocomial infections since they can resist disinfection on hospital surfaces and enhance their transmission. Biofilms can aggregate on tubular structures and tissues such as the urethra and invasive catheters and therefore constitute a significant cause of urinary tract infections and catheter-related infections that can be fatal, especially in immunocompromised hospitalized patients.29,30 Bacterial cells within the biofilm’s core can survive in a dormant state shutting down metabolism and enhancing their resistance to antimicrobial agents. Furthermore, a biofilm forms a mechanical barrier, protecting bacterial cells within the core from any contact with antibiotics and enhancing their survival in the presence of detergents and disinfectants.29

The third phenotypic indicator of virulence we examined was string formation, an indicator of hypervirulence. 11.8% of the Klebsiella pneumoniae clinical isolates were positive for this phenotype. As shown in Table 2, all the hypervirulent isolates were positive for the mrkD gene and were positively correlated with the wcaJ gene. wcaJ functions as an initiator enzyme for the synthesis of colonic acid by adding the first sugar (glucose-1-P) on the lipid carrier undecaprenyl phosphate.31 Strains harboring this gene often have a mucoid phenotype, whereas those strains without this glycosyltransferase lack colonic acid rendering them non-mucoid.32 The biosynthesized capsular polysaccharides lead to the mucoid phenotype, seen in the ability of Klebsiella pneumoniae strains harboring the gene to be hypermucoviscous/hypervirulent. A study conducted by Song et al. reported that Klebsiella pneumoniae isolates mutating in response to evolutionary pressures to resist bacteriophages showed nucleotide deletion mutations of wcaJ gene which rendered them dry and non-hypervirulent.16 This evidence underlines the importance of the wcaJ gene in hypervirulence. Other genes linked with the mucoid appearance and positive string test of Klebsiella pneumoniae include rmpA and magA genes.20,33

In contrast to the low hvKP prevalence in our study, other studies, especially in Taiwan and Asian countries, have reported a higher occurrence of hvKP. For example, findings from a study by Liu and Guo reported a hvKP prevalence of 45.7% (80/175) in China.34 In another study in 2017, Guo et al. reported a hvKP prevalence of 22.8% (84/369) in Klebsiella pneumoniae strains isolated from patients with invasive infections.35 Finally, Hao and colleagues reported a 68.8% prevalence rate of hvKP in a 2020 study conducted in China.36

Hypermucoviscous strains form a viscous string due to a mucus-like matrix produced by the bacterial cells. Results from this study show that hypermucoviscosity influences biofilm formation and serum resistance because out of the 12 hypervirulent strains, 11 of them were also serum non-susceptible and biofilm formers. The mucoid capsule of these hypervirulent strains facilitates the aggregation of bacterial cells into microcolonies that help form biofilms.12,37 Hypervirulence can also influence serum resistance since the mucoid slime layer masks key antigenic sites (Pathogen associated molecular patterns) that are recognizable by the immune system, especially the PRRs (Pathogen recognition receptors) that are found on immune cells patrolling the bloodstream and those stationed in sentinel sites mopping up any pathogens.8,20 Consequently, the bacterial cells are unrecognized by the host and can establish an infection.8

From the molecular screening of virulence factor genes, the mrkD gene was predominated at 95.1%, followed by ybtS, wcaJ, entD, and rmpA at 34.3%, 27.5%, 22.5%, and 0.98% respectively. Contrary to studies worldwide which indicate rmpA as a major virulence factor gene, it was rare in Klebsiella pneumoniae isolates from Kenya. When we examined which genes were more strongly associated with the virulence phenotypes, our study found that mrkD and ybtS had a strong statistical correlation with biofilm formation. mrkD is a type 3 fimbrial adhesin gene reported to facilitate biofilm formation in Klebsiella pneumoniae.19,38 A similar study in Egypt reported a strong statistical correlation between the mrkD gene and biofilm formation in Klebsiella pneumoniae.38 Another study conducted in Mosul also reported a strong statistical correlation between the presence of mrkD and biofilm formation phenotype.39 These studies validate the findings of this study. ybtS gene is crucial in the growth of Klebsiella pneumoniae since its translation product, ybtS enzyme, catalyzes the biosynthesis of yersiniabactin, facilitating iron acquisition from the environment or in vivo from the host’s transferrin and lactoferrin.19 A study by Han et al., reported that the ybtS gene had no significant effect on colony morphology and biofilm formation in Klebsiella pneumoniae, but it can significantly increase the virulence of Klebsiella pneumoniae strains.40 There are no published reports of the relationship between the presence/expression of the ybtS gene and biofilm formation. The strong correlation between the presence of mrkD, ybtS, and wcaJ genes with virulence traits suggests that they can be good vaccine targets to reduce the clinical impact of Klebsiella pneumoniae in Kenya.

The study had a few limitations. First, we only focused on a few virulence factor genes in a relatively small collection of Klebsiella pneumoniae isolates. These factors could have led to excluding or misrepresenting clinically relevant virulence genes in Kenyan isolates. The causal relationship of the genes with the phenotype was not examined using techniques such as gene knock-out or cloning to study the individual contributions of the genes to each phenotype. More virulence studies, including a more comprehensive panel of virulence genes and clinical isolates, should be conducted to understand the landscape of virulence factor genes among Klebsiella pneumoniae found in Kenya.

CONCLUSION

This study has shown that hypermucoviscous Klebsiella pneumoniae strains are circulating in Kenya, which is clinically significant as these hypervirulent Klebsiella pneumoniae strains are usually fatal 4,35. With most Klebsiella pneumoniae isolates circulating in Kenya being serum-resistant and biofilm formers, strong intervention measures like proper disinfection of hospital surfaces, management of catheter-associated infections, and environmental monitoring to eliminate biofilms need to be implemented to curb the spread of this bacteria. Studies like this that indicate the main virulence factor genes provide crucial data on the critical antigenic epitopes that should be targeted in vaccines for use in Kenya. Vaccine development to prevent severe infections and alternate approaches for biofilm control, like bacteriophages, should be emphasized to reduce the morbidity and mortality associated with hypervirulent Klebsiella pneumoniae.

Declarations

ACKNOWLEDGMENTS
The authors would like to thank the interns attached to the Kenya Medical Research Institute’s Center for Microbiology and the United States Army Medical Research Directorate – Africa (USAMRD-A), Felix Korir, Paul Kimani, and Moses Gachoya, for their technical support in sample analysis and Nicholas Lokomwa of State Department for the Blue Economy and Maritime Affairs for his help in data analysis. The authors also acknowledge USAMRD-A staff stationed in hospitals countrywide who collected the samples and the various study participants at the participating hospitals who consented to the bacterial pathogens isolated from their specimens to be used for further studies.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
FT, LM and AN conceptualized the study. FT, EO and MG applied methodology. FT and EO performed data analysis. FT and LM wrote original draft. LM and AN supervised the study. All authors read and approved the final manuscript for publication.

FUNDING
This research was partly funded by the Armed Forces Health Surveillance Division (AFHSD), Global Emerging Infections Surveillance (GEIS) Branch, ProMIS ID P0115_22_KY.

DATA AVAILABILITY
All datasets generated or analyzed during this study are included in the manuscript.

ETHICS STATEMENT
This study was approved by the Kenya Medical Research Institute (KEMRI) Scientific and Ethics Review Unit (KEMRI/SERU/CCR/176/4100), Jomo Kenyatta University of Agriculture and Technology (JKU/2/11/HSB325-1879/2017) and the National Commission for Science, Technology, and Innovation (NACOSTI/P/21/8450).

References
  1. Nirwati H, Sinanjung K, Fahrunissa F, et al. Biofilm formation and antibiotic resistance of Klebsiella pneumoniae isolated from clinical samples in a tertiary care hospital, Klaten, Indonesia. BMC Proc. 2019;13.
    Crossref
  2. Brogden KA, Guthmiller JM, Taylor CE. Human polymicrobial infections. Lancet. 2005;365(9455):253-255.
    Crossref
  3. Gorrie CL, Mirc Eta M, Wick RR, et al. Gastrointestinal Carriage Is a Major Reservoir of Klebsiella pneumoniae Infection in Intensive Care Patients. Clin Infect Dis. 2017;65(2):208-215.
    Crossref
  4. Sanchez-Lopez J, Garcia-Caballero A, Navarro-San Francisco C, et al. Hypermucoviscous Klebsiella pneumoniae: A challenge in community-acquired infection. IDCases. 2019;17:e00547.
    Crossref
  5. Phan MD, Peters KM, Sarkar S, et al. The Serum Resistome of a Globally Disseminated Multidrug Resistant Uropathogenic Escherichia coli Clone. PLoS Genet. 2013;9(10):e1003834.
    Crossref
  6. Zhang S, Zhang X, Wu Q, et al. Clinical, microbiological, and molecular epidemiological characteristics of Klebsiella pneumoniae-induced pyogenic liver abscess in southeastern China. Antimicrob Resist Infect Control. 2019;8(1):166.
    Crossref
  7. Vuotto C, Longo F, Balice MP, Donelli G, Varaldo PE. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens. 2014;3(3):743-758.
    Crossref
  8. Ballen V, Gabasa Y, Ratia C, Ortega R, Tejero M, Soto S. Antibiotic Resistance and Virulence Profiles of Klebsiella pneumoniae Strains Isolated From Different Clinical Sources. Front Cell Infect Microbiol. 2021;11:738223.
    Crossref
  9. Feldman MF, Mayer Bridwell AE, Scott NE, et al. A promising bioconjugate vaccine against hypervirulent Klebsiella pneumoniae. Proc Natl Acad Sci U S A. 2019;116(37):18655-18663.
    Crossref
  10. Muraya A, Kyany’a C, Kiyaga S, et al. Antimicrobial Resistance and Virulence Characteristics of Klebsiella pneumoniae Isolates in Kenya by Whole Genome Sequencing. Pathogens. 2022;11(5):545.
    Crossref
  11. Fang CT, Chuang YP, Shun CT, Chang SC, Wang JT. A Novel Virulence Gene in Klebsiella pneumoniae Strains Causing Primary Liver Abscess and Septic Metastatic Complications. J Exp Med. 2004;199(5):697-705.
    Crossref
  12. Mirzaie A, Ranjbar R. Antibiotic resistance, virulence-associated genes analysis and molecular typing of Klebsiella pneumoniae strains recovered from clinical samples. AMB Express. 2021;11(1):122.
    Crossref
  13. Donelli G, Vuotto C, Cardines R, Mastrantonio P. Biofilm-growing intestinal anaerobic bacteria. FEMS Immunol Med Microbiol. 2012;65(2):318-325.
    Crossref
  14. Podschun R, Sievers D, Fischer A, Ullmann U. Serotypes, Hemagglutinins, Siderophore Synthesis, and Serum Resistance of Klebsiella Isolates Causing Human Urinary Tract Infections. J Infect Dis. 1993;168(6):1415-1421.
    Crossref
  15. Babu L, Uppalapati SR, Sripathy MH, Reddy PN. Evaluation of recombinant multi-epitope outer membrane protein-based Klebsiella pneumoniae subunit vaccine in mouse model. Front Microbiol. 2017;8:1805.
    Crossref
  16. Song L, Yang X, Huang J, et al. Phage Selective Pressure Reduces Virulence of Hypervirulent Klebsiella pneumoniae Through Mutation of the wzc Gene. Front Microbiol. 2021;12:39319.
    Crossref
  17. Siu LK, Yeh KM, Lin JC, Fung CP, Chang FY. Klebsiella pneumoniae liver abscess: A new invasive syndrome. Lancet Infect Dis. 2012;12(11):881-887.
    Crossref
  18. Chen Y, Brook TC, Soe CZ, et al. Preterm infants harbour diverse Klebsiella populations, including atypical species that encode and produce an array of antimicrobial resistance-and virulence-associated factors. Microb Genomics. 2020;6(6):e000377.
    Crossref
  19. Amaretti A, Righini L, Candeliere F, et al. Antibiotic resistance, virulence factors, phenotyping, and genotyping of non-escherichia coli enterobacterales from the gut microbiota of healthy subjects. Int J Mol Sci. 2020;21(5):1847.
    Crossref
  20. Rastegar S, Moradi M, Kalantar-Neyestanaki D, Dehdasht AG, Hosseini-Nave H. Virulence factors, capsular serotypes and antimicrobial resistance of hypervirulent Klebsiella pneumoniae and classical Klebsiella pneumoniae in Southeast Iran. Infect Chemother. 2021;53(1):e39.
    Crossref
  21. Nahar N, Rashid RB. Phylogenetic analysis of antibiotic resistance genes and virulence genes of Klebsiella species in silico. Dhaka Univ J Pharm Sci. 2017;16(1):119-127.
    Crossref
  22. Jensen TS, Opstrup K V., Christiansen G, et al. Complement-mediated Klebsiella pneumoniae capsule changes. Microbes Infect. 2020;22(1):19-30.
    Crossref
  23. Tomas JM, Benedi VJ, Ciurana B, Jofre J. Role of capsule and O antigen in resistance of Klebsiella pneumoniae to serum bactericidal activity. Infect Immun. 1986;54(1):85-89.
    Crossref
  24. Apondi OE, Oduor OC, Gye BK, Kipkoech MK. High prevalence of multidrug resistant Klebsiella pneumoniae in a tertiary teaching hospital in Western Kenya. Afr J Infect Dis. 2016;10(2):85-89.
    Crossref
  25. Henson SP, Boinett CJ, Ellington MJ, et al. Molecular epidemiology of Klebsiella pneumoniae invasive infections over a decade at Kilifi County Hospital in Kenya. Int J Med Microbiol. 2017;307(7):422-429.
    Crossref
  26. Ku YH, Chuang YC, Chen CC, et al. Klebsiella pneumoniae Isolates from Meningitis: Epidemiology, Virulence and Antibiotic Resistance. Sci Rep. 2017;7(1):6634.
    Crossref
  27. Seifi K, Kazemian H, Heidari H, et al. Evaluation of biofilm formation among Klebsiella pneumoniae isolates and molecular characterization by ERIC-PCR. Jundishapur J Microbiol. 2016;9(1):e30682.
    Crossref
  28. De Araujo C, Balestrino D, Roth L, Charbonnel N, Forestier C. Quorum sensing affects biofilm formation through lipopolysaccharide synthesis in Klebsiella pneumoniae. Res Microbiol. 2010;161(7):595-603.
    Crossref
  29. Vuotto C, Longo F, Pascolini C, et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol. 2017;123(4):1003-1018.
    Crossref
  30. Rendueles O. Deciphering the role of the capsule of Klebsiella pneumoniae during pathogenesis: A cautionary tale. Mol Microbiol. 2020;113(5):883-888.
    Crossref
  31. Cai R, Wang G, Le S, et al. Three capsular polysaccharide synthesis-related glucosyltransferases, GT-1, GT-2 and WcaJ, are associated with virulence and phage sensitivity of Klebsiella pneumoniae. Front Microbiol. 2019;10:1189.
    Crossref
  32. Pal S, Verma J, Mallick S, Rastogi SK, Kumar A, Ghosh AS. Absence of the glycosyltransferase wcaj in Klebsiella pneumoniae ATCC13883 affects biofilm formation, increases polymyxin resistance and reduces murine macrophage activation. Microbiol (United Kingdom). 2019;165(8):891-904.
    Crossref
  33. Cubero M, Grau I, Tubau F, et al. Hypervirulent Klebsiella pneumoniae clones causing bacteraemia in adults in a teaching hospital in Barcelona, Spain (2007-2013). Clin Microbiol Infect. 2016;22(2):154-160.
    Crossref
  34. Liu C, Guo J. Hypervirulent Klebsiella pneumoniae (hypermucoviscous and aerobactin positive) infection over 6 years in the elderly in China: Antimicrobial resistance patterns, molecular epidemiology and risk factor. Ann Clin Microbiol Antimicrob. 2019;18(1):4.
    Crossref
  35. Guo Y, Wang S, Zhan L, et al. Microbiological and clinical characteristics of hypermucoviscous Klebsiella pneumoniae isolates associated with invasive infections in China. Front Cell Infect Microbiol. 2017;7:24.
    Crossref
  36. Hao Z, Duan J, Liu L, et al. Prevalence of Community-Acquired, Hypervirulent Klebsiella pneumoniae Isolates in Wenzhou, China. Microb Drug Resist. 2020;26(1):21-27.
    Crossref
  37. Ye M, Tu J, Jiang J, et al. Clinical and genomic analysis of liver abscess-causing Klebsiella pneumoniae identifies new liver abscess-associated virulence genes. Front Cell Infect Microbiol. 2016;6:165.
    Crossref
  38. Elbrolosy AM, Eissa NA, Al-Rajhy NA, El-Mahdy EE-SA, Mostafa RG. MrkD Gene as a Regulator of Biofilm Formation with Correlation to Antibiotic Resistance among Clinical Klebsiella pneumoniae Isolates from Menoufia University Hospitals. Egypt J Med Microbiol. 2020;29(3):137-144.
    Crossref
  39. Mahmood MT, Abdullah BA. The relationship between biofilm formation and presence of fimH and mrkD genes among E. coli and K. pneumoniae isolated from patients in Mosul. Mosul J Nurs. 2015;3(1):34-42.
    Crossref
  40. Han R, Niu M, Liu S, Mao J, Yu Y, Du Y. The effect of siderophore virulence genes entB and ybtS on the virulence of Carbapenem-resistant Klebsiella pneumoniae. Microb Pathog. 2022;171:105746.
    Crossref

Article Metrics

Article View: 4543

Share This Article

© The Author(s) 2023. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.