Open Access
Garima Verma1 , Nadim Chishty1 and Chandra Veer2
1Department of Zoology, Government Meera Girls College, Mohan Lal Sukhadia University, Udaipur – 313 001, Rajasthan, India.
2Department of Dairy & Food Microbiology, College of Dairy & Food Science Technology, MPUAT, Udaipur, Rajasthan, India.
J Pure Appl Microbiol. 2017;11(2):975-979
https://doi.org/10.22207/JPAM.11.2.39 | © The Author(s). 2017
Received: 10/12/2016 | Accepted: 10/01/2017 | Published: 30/06/2017
Abstract

The present study deals with isolation and characterization of lead resistant bacteria isolated from two water bodies Udaisagar lake and Gadwa pond of Berach river system, Udaipur, Rajasthan, India. Initially, among 13 of the total isolates screened from water samples, 2 isolates were selected for study based on high level of heavy metal resistances. On the basis of morphological, biochemical and molecular characterization using 16S rDNA sequencing the isolates were identified as Pseudomonas stutzeri (KX692284) and Pseudomonas stutzeri (KX692285). The isolates exhibited high resistance to lead (Pb). The Minimum Inhibitory concentration (MIC) of the isolates against lead was determined using agar plate dilution method. Pseudomonas stutzeri showed highest MIC value for lead up to 1300 mg/l concentration. The uptake of heavy metals, present in water and detoxification of metal ions by bacteria provide an additional mechanism of environmental bioremediation. The identified lead resistant bacteria could be useful for the bioremediation of lead contaminated sewage and waste water from various industries.

Keywords

Pseudomonas stutzeri, Lead Resistant Bacteria, Minimum Inhibitory concentration (MIC), bioremediation, 16S rDNA sequencing.

Introduction

Heavy metal pollution of soil and wastewater is a significant environmental problem (Cheng, 2003). Wastewaters from the industries and sewage sludge applications have permanent toxic effects to human and the environment (Rehman et al., 2008). It is well established that domestic sewage and industrial effluents that fall into natural water bodies change the water quality and lead to eutrophication. Water quality means the physical, chemical and biological characteristics of water. Various pollutants influence the water quality of water bodies and there by influencing the biota therein. Unlike many other pollutants, heavy metals are difficult to remove from the environment (Ren et al., 2009). Some heavy metals are useful to us in low concentrations but are highly toxic in higher concentrations (Ge et al., 2009). Lead is hazardous to children even in very low concentration and causes mental retardation. Chemical methods such as precipitation, evaporation, electroplating, ion-exchange etc. have been widely used to remove metal ions from industrial waste water but these methods are ineffective or expensive and have several disadvantages such as unpredictable metal ion removal, high reagent requirement, generation of toxic sludge etc. There are a number of biological materials that can be use to remove metals from waste water, such as molds, yeasts, bacteria, and seaweeds (Vieira and Volesky, 2000 and Waisberg et al., 2003). The ability of micro-organisms is recognized for environmental management, and microbes have superseded the conventional techniques of remediation. This ability of microbial stains to grow in the presence of heavy metals would be helpful in the waste water treatment where microorganisms are directly involved in the decomposition of organic matter in biological processes for waste water treatment (Munoz et al., 2006 and Prasenjit, 2005) In this study two water bodies lake Udaisagar and Gadwa pond belonging to Berach river system, Udaipur region were selected to isolate and characterize lead resistant bacteria. The morphological, biochemical and molecular characterization using 16S rDNA sequencing of isolates have been done to identify the metal resistant isolates. These isolates can be used to remove toxic lead from industrial effluents.

Materials and Methods

Sample collection
Samples of water were collected from heavy metal contaminated sites of Udaisagar lake and Gadwa pond, Udaipur, Rajasthan, India and kept in sterile bottles under refrigeration to ensure minimal biological activity until processing in laboratory.

Isolation of lead resistant bacteria
Lead resistant bacteria were isolated on nutrient agar supplemented with 100 mg/l concentration of lead acetate trihydrate by the standard pour plate method. Plates were incubated at 37oC for 24-48 hours.

Morphological and Biochemical characterization of lead resistant bacteria
Characterization of isolates was done by studying morphological (Gram staining and shape) and biochemical characteristics (catalase activity, oxidase activity, acid production from glucose, citrate utilization, nitrate reduction). The tests were used to identify the isolates according to Bergey’s Manual of Systematics Bacteriology (Claus and Berkeley, 1986).

Determination of Minimum Inhibitory Concentration (MIC) of lead for isolates
The MIC was defined as the lowest concentration of the heavy metal that inhibits the visible growth of the organisms. After the preliminary isolation of the lead tolerant bacteria, the minimum inhibitory concentration (MIC) of lead was determined by agar plate dilution method as adopted by Malik and Jaiswal, (2000). The metal lead was used in different concentration ranging from 1000mg/l to 2000 mg/l. Stock solutions of the metal salt (lead acetate) 4g/100 ml were prepared in sterile water to obtain final concentrations of 600 to 1500 mg/l lead. The petri plates were inoculated with 10 µl of an overnight broth culture and incubated at 37ºC for 24-72 hours.

Isolation of genomic DNA
Genomic DNA from all the isolates was extracted with some modification in phenol chloroform method. Bacteria were cultured overnight in nutrient broth and 1.5 ml of culture was harvested in TE buffer (pH 8). Lysis was initiated by the addition of lysozyme (4mg/ml). After incubation at 37°C for 30 minutes, 40 µl of 10% sodium dodecyl sulphate (SDS) was added and the tubes were incubated at 45°C for 60 minutes. Cell debris and protein were separated with phenol and chloroform extraction and DNA was precipitated by adding sodium acetate (3M) and twice volumes of absolute ethanol. Tubes were incubated at -20°C for 12 hours. After incubation, tubes were centrifuged and the pellet was washed with 70% ethanol and air dried. The pellet was dissolved in 100 µl of TE buffer and stored at -20°C for further use.

16s rDNA amplification
The 16s rRNA gene of bacteria was amplified using 16s rRNA gene sequence as forward primer (5’AGAGTTTGATCCTGGCTCAG-3’) and as reverse primer (5’ AAGGAGGTGATCCAGCCGCA 3’). The PCR conditions were standardized as follows. Initial denaturation at 94°C for 5 minutes, 35 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 45 sec and extension at 72°C for 1 minutes and the final extension at 72°C for 10 minutes. The resulting amplified products were run on 1.5% agarose gel and visualized by using gel documentation system (Gel Doc XR+, Bio Rad).

Sequence analysis
Amplified 16s rDNA products were sequenced from Bioinovations, Mumbai. Sequencing was determined by the dideoxy chain termination method. The closest relatives of 16S rDNA sequences were determined by a search of the GenBank DNA database using the BLAST algorithm. Homology comparisons were performed using the Basic Local Alignment Search Tool (BLAST), online at the National Centre for Biotechnology Information (NCBI) homepage (www.ncbi.nlm.nih.gov). Identities of isolates were determined based on the highest score.

RESULTS

Isolation of lead resistant bacteria
A total 13 indigenous bacterial strains were recovered from water samples on nutrient agar supplemented with 100 mg/l concentration of lead acetate trihydrate by the standard pour plate method. Further all of these isolates were grown on 500 mg/ml concentration of lead. Out of them, two strains GVP1a and GVP2 were selected that showed growth at this concentration.

Morphological and Biochemical characterization
Two selected isolates were characterized by detecting their cultural, morphological and biochemical characteristics (Table 1). The investigation results indicated that both the isolates were gram-negative, motile rod-shaped bacteria and gave positive reaction for catalase activity, oxidase activity, reduces nitrate and utilizes citrate. Both the isolates gave negative reaction for fermentation of glucose. The above results obtained for morphological and biochemical characteristics were further matched with Bergey’s Manual of Systematics Bacteriology (Claus and Berkeley, 1986).

Table (1):
Morphological and Biochemical characterization of lead resistant isolates

Characteristics Lead resistant Isolates
GVP1a GVP2
Morphology (Colony colour and Shape) Pale color, irregular Pale color, irregular
Cell Shape Rod Rod
Gram Reaction
Catalase + +
Oxidase + +
Citrate Utilization + +
Nitrate Reduction + +
Glucose Fermentation

+ = Positive, – = Negative

Minimum Inhibitory Concentration of lead ions
The MIC of lead was determined using increasing concentrations of lead (1000 to 2000 mg/l). The growth of the isolate GVP1a and isolate GVP2 were observed after 72 hours of incubation in the nutrient agar medium up to 1200 and 1300 mg/l concentration of lead. The result showed in Table 2 revealed that MIC of lead for isolates GVP1a and GVP2 was 1200 and 1300 mg/l respectively. Isolate GVP2 showed maximum value of MIC. GVP1a and GVP2 didn’t show any growth on higher concentration of lead (1300 mg/l and 1400 mg/l respectively).

Table (2):
Minimum Inhibitory Concentration (MIC) values of lead for two lead resistant isolates

Isolate
MIC (mg/l)
GVP1a
1400
GVP2
1600

Molecular identification of lead tolerant bacteria
Genomic DNA was isolated and visualized on 1.0 percent agarose gel. For the identification of isolates at species level the 16S rDNA amplification was done using PCR technique. Amplified products were run in 1.5 percent agarose gel and visualized using gel documentation system. The amplified products of isolates were sequenced and the obtained sequences were compared with the available gene sequences at NCBI website by using BLASTn. Sequences submitted to GenBank, USA (Table 3) showing more than 95% similarity with the GenBank sequences.

Table (3):
Accession numbers generated by GenBank, NCBI, USA for submitted nucleotide sequences of lead tolerant isolates

S. No.
Isolate
Accession number
Name of identified strain
1
GVP1a
KX692284
Pseudomonas stutzeri
2
GVP2
KX692285
Pseudomonas stutzeri
DISCUSSION

Heavy metal resistant bacteria have been isolated from soil, industrial effluents, fresh water bodies, rivers, waste water and sewage (Mgbemena et al., 2012; Pandit et al., 2013; Narasimhulu et al., 2010; Murthy et al., 2012). In this study lead resistant bacteria were isolated from polluted sites of water bodies named as Udaisagar lake and Gadwa pond of Berach river system, Udaipur.

A total of 13 bacterial isolates were recovered on nutrient agar supplemented with 100 mg/l concentration of lead acetate. Out of them 2 isolates were selected on the basis of high level of lead resistance (up to 500 mg/l). Morphological characterization of isolates showed these isolates as Gram-negative species. It shows that Gram-negative bacteria have the ability of heavy metal resistance which was also reported in studies of heavy metal resistances. (Bhojia and Joshi, 2014; Bhojia and Joshi, 2012). Pseudomonas stutzeri isolates GVP1a and GVP2 showed high level of Minimum inhibitory concentration values 1200 and 1300 mg/l respectively. Maximum MIC of lead for the isolates was found upto 1300 mg/l. MIC value of lead for Bacillus cereus was reported at 1000mg/l concentration and MIC of zinc at 10mM for Pseudomonas aeruginosa (by Murthy et al, 2012 and Bhojiya and Joshi, 2012). Molecular Identification of metal resistant bacteria have been done using 16S rDNA sequencing technique, this technique was also used in various studies for the identification of metal resistant isolates at species level. (Chatterjee et al., 2012; Pandit et al., 2013). In this study Pseudomonas stutzeri was identified as lead resistant bacteria. Similarly Pseudomonas sp. have been identified as heavy metal resistant bacteria by Bhojiya and Joshi, 2014 and Pseudomonas aeruginosa HMR1 and Pseudomonas aeruginosa HMR16 have been identified as zinc tolerant bacteria (Bhojiya and Joshi, 2012).

CONCLUSION

The industrial effluents and waste water are rich source of heavy metals and bacteria reside in them must be resistant to heavy metals. The isolation of lead resistant bacteria from polluted sites of Udaisagar lake and Gadwa Pond and their molecular characterization using 16S rDNA sequencing up to species level lead to the application of these isolates for the removal of lead from waste water. The results of the study suggest that Pseudomonas stutzeri species can be useful for the bioremediation of lead contaminated industrial effluents and waste waters.

Declarations

ACKNOWLEDGMENTS
The first author gratefully acknowledges the financial support received from Rajiv Gandhi National Fellowship, University Grant Commission, New Delhi.

References
  1. Bhojia, A.A. and Joshi, H. Isolation and characterization of zinc tolerant bacteria from Zawar mines Udaipur, India. Inter. J. Env. Eng. Manag., 2012; 3(4): 239-42.
  2. Bhojia, A.A. and Joshi, H. Characterization and zinc tolerance of pseudomonas isolated from Zawar mines Udaipur, India. J. Herb. Medi. and Toxi., 2014; 8(1): 62-66.
  3. Chatterjee, S., Mukherjee, A., Sarkar, A. and Roy, P. Bioremediation of lead by lead resistant microorganisms, isolated from industrial sample. Adv. Biosci. Biotech., 2012; 3: 290-95.
  4. Cheng, S. Heavy metal pollution in China:origin, pattern and control. Env. Sci. Pol. Res., 2003; 10:192-98.
  5. Claus D. and Berkeley, R.C.W. “Genus Pseudomonas. In:Bergey’s Manual of Systematic Bacteriology,” P.H.A. Sneath, N.S. Mair and M.E. Sharpe, Eds. Baltimore: Williams and wilkins, 986, 1:  pp. 140-219.
  6. Ge, H.W., Lian, M.F., Wen, F.Z., Yun, Y.F., Jian, F.Y.and Ming, T. Isolation and characterization of the heavy metal resistant bacteria CCNWRS33-2 isolated fromroot nodule of Lespedeza cuneata in gold mine tailings in China. J. Haz. Mate., 2009; 162:50-56. doi:10.1016/j.jhazmat.2008.05.040
  7. Malik, A. and Jaiswal, R. “Metal resistance in Pseudomonas strains isolated from soil treated with industrial wastewater,” World. J. Microbiol. Biotechnol., 2000; 16; pp. 177–182.
  8. Mgbemena, C., Nnokwe, J. C., Adjeroh, L. A., & Onyemekara, N. N. Resistance of bacteria isolated from Otamiri river to heavy metals and some selected antibiotics. Cur. Res. J. Bio. Sci., 2012; 4(5): 551-56.
  9. Munoz, R.A., Munoz, M.T., Terrazas, E., Guieysse, B. and Mattisasson, B. Sequential removal of heavy metals ions and organic pollutants using an algal-bacterial consortium. Chemo., 2006; 63: 903-991. doi:10.1016/j.chemosphere.2005.09.062
  10. Murthy, S., Bali, G. and Sarangi S. K. Lead biosorption by a bacterium isolated from industrial effluents. Inter. J.Micro. Res., 2012; 4(3): 196-200.
  11. Narasimhulu, K., Rao, P. S. and Vinod, A. V. Isolation and identification of bacteria strains and study of their resistance to heavy metals and antibiotics. J. Micro. Bioch. Tech., 2010; 2(3): 74-76.
  12. Pandit, R. J., Patel, B., Kunjadia, P. D., & Nagee, A. Isolation, characterization and molecular identification of heavy metal resistant bacteria from industrial effluents, Amala-khadi- Ankleshwar, Gujarat. Inter. J.Env. Sci., 2013; 3(5):1689-99.
  13. Prasenjit, B. Sumathi, and S. Uptake of chromium by Aspergillus foetidus. Journal of Material Cycles and Waste Management, 2005; 7, 88-92.doi:10.1007/s10163-005-0131-8
  14. Rehman, A. Z., Muneer, B., & Hasnain, S. Chromium tolerance and reduction potential of a Bacillus sp.ev3 isolated from metal contaminated wastewater. Bulletin of Environment and Contamination Toxicology, 2008; 81, 25-29.
  15. Ren, W. X., Li, P. J., Geng, Y., & Li, X. J. Biological leaching of heavy metals from a contaminated soil by Aspergillus niger. Journal of Hazardous materials, 2009; 167(1-3), 164-169.
  16. Vieira, R. and Volesky, B. Biosorption: a solution to pollution? International Journal of Food Microbialogy, 2000; 3, 17-24.
  17. Waisberg, M., Joseph, P., Hale, B. and Beyersmann, D. Molecular mechanism of cadmium carcinogenesis.Toxicology, 2003; 192, 95-117. doi:10.1016/S0300-483X(03)00305-6

Article Metrics

Article View: 6196

Share This Article

© The Author(s) 2017. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.