Research Article | Open Access
Hamid Ahmad Shah1 , Arshi Syed2, Mohd Altaf Bhat3, Dalip K. Kakru1, Shaheen Farooq3, Sabia Qureshi4, Azhar Shafi2, Burhan Nabi5 and Anil Taku6
1Department of Microbiology, SMSR, Sharda University, Greater Noida, Uttar Pradesh, India.
2Department of Microbiology SKIMS Medical College, Bemina, Srinagar, Jammu & Kashmir, India.
3Department of Veterinary Microbiology & Immunology, F.V.Sc & A.H., SKUAST-K, Shuhama, Srinagar, Jammu & Kashmir, India.
4Department of Microbiology & Immunology, F.V.Sc & A.H., SKUAST-K, Shuhama, Srinagar, Jammu & Kashmir, India.
5Department of Veterinary Medicine, Khalsa College of Veterinary and Animal Sciences, Amritsar, Punjab, India.
6Department of Veterinary Microbiology, F.V.Sc & A.H., SKUAST-Jammu, Jammu & Kashmir, India.
Article Number: 8718 | © The Author(s). 2023
J Pure Appl Microbiol. 2023;17(3):1679-1690. https://doi.org/10.22207/JPAM.17.3.32
Received: 22 May 2023 | Accepted: 19 July 2023 | Published online: 01 September 2023
Issue online: September 2023
Abstract

The growing prevalence of antibiotic-resistant bacteria is a worldwide public health apprehension, and Escherichia coli (E. coli) is one of the most commonly implicated bacterial species. Among E. coli isolates, extended-spectrum β-lactamase (ESBL)-producing strains have been identified as a key contributor to antibiotic resistance. Penicillin’s, cephalosporins, and monobactams are only a few of the β-lactam antibiotics that can be rendered inactive by ESBLs. This investigation’s goals were to determine the prevalence of ESBL-producing E. coli isolates found in clinical samples and to analyze the distribution of the blaTEM, blaSHV, and blaCTX-M genes among them. Additionally, we aimed to determine the antibiotic susceptibility patterns of these isolates to other antibiotics. Clinical isolates from urine, ear swab, and wound/pus swabs were collected from patients with suspected E. coli bacterial infections from different regions of north India viz., SKIMS-JVC medical college and NABL accredited Dr. Qadri’s Lab both from Srinagar Kashmir valley region and SMSR, SU from Greater Noida UP. Standard laboratory techniques were used to identify E. coli isolates, and the combined disc method and other phenotypic confirmation techniques were used to confirm ESBL formation. PCR amplification and sequencing were used to find the blaTEM, blaSHV, and blaCTX-M genes. The Kirby-Bauer disc diffusion method was used to test the antimicrobial susceptibility of various bacteria to different antibiotics. A total of 210 E. coli isolates were collected from different clinical samples and only 158 isolates showed positive results for ESBL by DDST and phenotypic confirmatory tests. Of these, 124 (78.48%) were ESBL-producing isolates. We found that blaTEM was the most prevalent gene (45.16%), followed by blaCTX-M (34.16%) and blaSHV (12.09%). Antimicrobial resistance profiles were assessed for each of the 120 isolates. Ampicillin and Cefepime were the most resistant drugs to ESBL-producing isolates, followed by Gentamicin, Ceftriaxone, and Cefixime.

Keywords

ESBL, PCR, DDST, Antimicrobial Susceptibility, Enterobacteriaceae

Introduction

Escherichia coli (E. coli) is one of the bacterial species of particular concern as a result of the rising incidence of antibiotic-resistant bacteria, which is a global public health issue.1 Both community-acquired and hospital associated infections are caused by this pathogen and have shown increasing resistance to third-generation cephalosporins, which can cause more expensive hospital stays, greater mortality and morbidity rates.2 The major challenge for the physicians nowadays is treating ESBL producing Strains. Extended-spectrum-beta-lactamase (ESBL)-producing strains of E. coli have been discovered as a significant cause of antibiotic resistance.3,4 ESBLs are enzymes that render various beta-lactam antibiotics inactive including cephalosporins and monobactams. Due to the widespread usage of these antibiotics, resistance has emerged.5 Occurrence of carbapenem resistance is also rapidly increasing in E. coli due to the production of different types of enzymes called carbapenemases. These enzymes have potential to hydrolyze almost all β-lactams, including carbapenems the genes of which are located on mobile genetic element (MGE) called plasmids. Due to the majority of cross resistance between beta-lactamases produced by Enterobacteriaceae and other classes of commonly used antibiotics, such as aminoglycosides, trimethoprim sulfamethoxazole, and fluoroquinolones, only a limited number of therapeutic options are available in a hospital setting. There is very high hospital stay expenses and high mortality rates associated with these multidrug resistant organisms in contrast to non β-lactamase producing Enterobacteriaceae. Thus, the surveillance and monitoring of these β-lactamase producing Enterobacteriaceae is important for clinical care.6 Three main types of ESBL’s have been recognized which are TEM, SHV, and CTX-M. In terms of prevalence, CTX-M has surpassed SHV and TEM. CTX-M belongs to rapidly growing family that has expanded over a variety of clinically significant bacteria and vast geographic regions.7 Understanding susceptibility patterns is important because of the rising rates of bacterial resistance which is a major global problem this is because prolonged hospital stays and higher mortality rates can result from the widespread and inappropriate use of antimicrobial therapy which can be prevented by providing right treatment.8 In this investigation, the prevalence of the ESBL phenotype was attempted to be ascertained, and clinical isolates were examined for the presence of the blaTEM, blaSHV, and blaCTX-M genes.

Materials and Methods

The study was caried out in department of veterinary microbiology SKUAST-K and department of microbiology SMSR, SU from Jan 2021 to Dec 2022. A total of 210 E.coli isolates from various samples collected from different location in the Kashmir valley and Noida UP region (Table 1). The source of these isolates includes urine, ear swab, and wound/pus swabs These isolates were collected from patients with suspected E.coli infections. The contributing centres were department of Microbiology of the Sher-e-Kashmir Institute of Medical Sciences, Jhelum Valley Medical College, Bemina, Srinagar Kashmir, India and NABL accredited Dr. Qadri’s Haematology Center & Clinical Laboratory, Srinagar Kashmir, India and Sharda School of Medical Sciences & Research, Sharda Hospital, Greater Noida, UP, the distribution of which is follows:

Table (1):
Details of isolates collected from different locations

S.No. Location Isolates Total
Urine Wound/Pus Ear Swab
1. SKIMS-JVC 64 16 10 90
2. Qadri Hematology Lab. 59 12 09 80
3. SMSR, Sharda University 29 08 03 40
Total 152 36 22 210

The isolates were produced from the cultures of a variety of clinical samples taken from both in-patients and out-patients who were admitted to the hospitals from the aforementioned centres. By sub-culturing on MacConkey agar, all the bacterial cultures underwent a second test for viability and purity (Figure 1).

Figure 1. Isolation of E. coli on MacConkey’s Lactose Agar

Preliminary phenotypic and biochemical testing were conducted to validate the identity of isolates:

Gram staining
On a clean grease free slide, bacterial smears from 16-18 hrs were prepared, heat fixed and stained with Gram stain and observed under 100x oil immersion microscope.

Motility test
Motility of the organism was observed using hanging drop technique

Catalase test
On a clean grease free slide, a small amount of bacterial culture was mixed with drop of 3% H2O2. Appearance of effervescence is an indication of catalase positive otherwise negative.

Oxidase test
The culture was smeared on oxidase discs (Himedia) with the inoculation loop. Appearance of blue or purple color within 10 seconds in an indication or oxidase positive otherwise negative.

Isolation of Presumptive ESBL producing Escherichia coli
Presumptive isolates were inoculated in nutritional broth and incubated at 37°C until the suspension met the 0.5McFarland standard (1.5×108 CFU/mL). Around 10µl of the suspension was spread using a sterile spreader on ESBL ChromoSelect Agar (Sigma-Aldrich) plates. The media was prepared by dissolving 40 grams in one liter of distilled water and heated to dissolve it completely. Sterilization of media was done by autoclaving at 15lbs pressure (121°C) for 15 minutes, cooled to 50°C and rehydrated contents of two vials of ESBL ChromoSelect Selective Supplement (Cat #61471, Sigma) was added, mixed well and poured into sterile petri plates. From each plate two pink colonies were selected and then on nutrient agar slant colonies were streaked and then overnight incubation was done and kept at 4°C for further analysis (Figure 2).

Figure 2. Isolation of ESBL producing E. coli on Chromogenic agar

Phenotypic tests for the detection of ESBLs
Use of disk diffusion test to check resistance to Ceftazidime and Cefotaxime by presumptive ESBL producing E. coli. As recommended by Clinical and Laboratory Standards Institute (CLSI), the ESBL isolates underwent disc diffusion testing in order to check resistance against cefotaxime and ceftazidime (Figure 3). Each isolate was suspended in the nutrient broth and a suspension was made whose turbidity matches with 0.5 McFarland standard (1.5×108 CFU/mL). The bacterial suspension was then spread on Mueller Hinton agar with a sterilised cotton swab to produce a uniform lawn culture. Antibiotics disc of cefotaxime and ceftazidime were placed on the surface of Muller Hinton agar plate after the plate had dried, and incubation was done for 18-24 hours at 37°C. Zone of inhibition around the discs were measured and recorded. For concluding resistance disk potency and inhibition zone diameters were used as shown in Table 2. Isolates were declared to be ESBL positive even if they show resistance to one of the antibiotic disc.

Figure 3. Screening of ESBL E. coli isolates for resistance to ceftazidime (CAZ) (Left) and cefotaxime (CTX) (Right) by disk diffusion method

Table (2):
Disk concentration and zone diameters for inferring resistance in the screening test

Antibiotic disk
Resistant, if zone diameter was
Cefotaxime-CTX (30 μg)
≤ 17 mm
Ceftazidime-CAZ (30 μg)
≤ 22 mm

Confirmation of ESBL producing E. coli by Cephalosporin/Clavulanate combination disks
Double disc synergy test was performed as per CLSI guidelines in 2010 for those isolates which were resistant to one of the antibiotics viz. Cefotaxime and Ceftazidime. The isolates were grown in nutrient broth till they matched 0.5McFarland standard (1.5×108 CFU/mL). Bacterial suspension was spread on the Muller Hinton agar plates uniformly. After the plates dry, antibiotic discs containing cefotaxime, cefotaxime+ clavulanic acid and ceftazidime, ceftazidime+clavulanic acid were placed on the surface of the plates and incubated for 18-24 hours at 37°C. After overnight incubation and visible growth, zone of inhibition around the discs were measured and recorded. Increase in zone diameter of 5mm around the antibiotic disc containing cephalosporins and clavulanic acid over the antibiotic disc containing cephalosporin alone is an indicative of ESBL production (Figure 4).

Figure 4. Phenotypic confirmation of ESBLs production in E. coli isolates by disk diffusion method using cefotaxime (CTX) and cefotaxime+clavulanic (CEC) acid disks

Etest for ESBLs
HiMedia, India, makes plastic drug-impregnated strips which has gradient of antibiotic on both the sides with one end containing ceftazidime (MIC test range 0.5 to 32 µg/mL) and other end containing ceftazidime (MIC test range 0.064 to 4 µg/mL) and a fixed concentration of clavulanate (4 µg/mL). Similar strips of cefotaxime (MIC test range 0.25 to 16 µg/mL) and cefotaxime (MIC test range 0.016 to 1µg/mL) plus a fixed concentration of clavulanate (4µg/mL)are also available. Both screening and phenotypic confirmation of ESBL production was done by these strips. Pure cultures of bacteria cultivated overnight on MacConkey agar were used to create a suspension in nutrient broth that matched the 0.5McFarland (1.5×108 CFU/mL) standard. Lawn culture was made on Muller Hinton agar with sterile cotton swab. The antibiotic impregnated strips were placed on Muller Hinton agar after the plates dry at desired position. The strips became absorbed and firmly attached to the agar surface after 60 seconds and plates were incubated for 18-24 hours at 37°C. Read the MIC at the point on the strip where the ellipse crossed the MIC scale. If the isolates displayed a 8-fold reduction in cephalosporin MICs in the presence of clavulanate, they were deemed to be phenotypically confirmed ESBLs(As per manufacturer’s instructions(HiMedia) (Figure 5).

Figure 5.  Phenotypic confirmation of ESBLs production in E. coli isolates by Etest using ceftazidime/ ceftazidime + clavulanic acid Strip (Left) and cefotaxime / cefotaxime+clavulanic acid strip (Right)

Molecular characterization of ESBL producing E. coli isolates
Extraction of bacterial DNA
After ESBL producers were identified phenotypically, isolates were subjected to molecular analysis. A loopful of bacterial growth was obtained from nutritional agar slants and suspended in 500 microliters (µL) of sterile distilled water in a 2 mL microcentrifuge tube. The DNA was then extracted using the snap and chill technique, which involves boiling colonies suspended in distilled water for 10 minutes to release the DNA, followed by 10 minutes of cooling on ice and 1 minute of 10,000 g centrifugation in a Table top microcentrifuge (Biofuge Stratus, Heraeus). Around 2µL of the supernatant were utilized as the template for the polymerase chain reaction (PCR).

Detection of ESBL producing E. coli isolates
All the isolates that were phenotypically determined to produce ESBLs were subjected to multiplex PCR (m-PCR) testing using particular primers to check for the presence of the blaTEM, blaSHV, and blaCTX-M genes. (Table 3). The PCR amplification was carried out in 25µL reaction volumes in 0.2 mL thin walled PCR tubes (Eppendorf, Germany). The PCR mixture consists of DNA template, Go-green Master Mix (Promega, premixed ready-to-use solution containing Taq DNA polymerase derived from bacteria, dNTPs, MgCl2 and reaction buffers), specific primers and Nuclease free water. Negative template control was sterile distilled water. The following cycling parameters were used during PCR in the Mastercycler Gradient Thermal cycler (Eppendorf, Germany): an initial denaturation at 95°C for 15 min; followed by 30 cycles of amplification each consisted of 30 s of denaturation at 94°C; 90 s of annealing at 62°C and 60 s of elongation at 72°C. The mixture was subjected to final elongation at 72°C for 10 min. The DNA extracted from the positive isolate maintained by the Division of Veterinary Microbiology and Immunology, SKUAST-Kashmir was included as positive control in the PCR reaction. Sterile distilled water was used as negative control. All the nucleotide primers used throughout the study were procured from Integrated DNA Technologies, USA.

Table (3):
Predicted amplicon length and a sequence of primers used to detect various beta-lactamase genes in multiplex PCR

Primer Sequence (5´ – 3´) Target  gene Amplicon size (bp) References
blaSHV-F CTT TATCGGCCCTCACTCAA blaSHV 237 [8]
blaSHV-R AGGTGCTCATCATGGGAAAG
blaTEM-F CGCCGCATACACTATTCTCAGAAT GA  

blaTEM

445 [9]
blaTEM-R ACGCTCACCGGCTCCAGATTTAT
blaCTX-M/F ATGTGCAGYACCAGTAARGTKATGGC  

blaCTX-M

593 [10]
blaCTX-M/R TGGGTRAARTARGTSACCAGAAYCAGCGG

Electrophoresis and documentation
Agarose gel (1.5% w/v) was made by heating the appropriate amount of agarose (Sigma Aldrich, St. Louis, USA) with 40 mL 1X Tris acetate EDTA (TAE) buffer in a 500 mL Erlenmeyer flask. The flask was cooled to 60°C and ethidium bromide was added to the final concentration of 0.5µg/mL. The gel casting tray made of plastic was filled with warm agarose and a comb with 0.5 to 1mm wells was placed in the gel casting tray and allowed to set for around 30 minutes at room temperature. The comb was removed, and the gel was put on a Biometra electrophoresis tank that contained 1X TAE buffer. The wells in gel submerged in buffer tank were loaded with PCR products and standard molecular weight marker (Cat #DM003-R500, GeneDireX) was loaded in one well. The gel received a voltage of 5 V/cm across the ends until the yellow loading dye migrated to particular distance. The gel was removed carefully from the buffer and visualized under ultraviolet illumination and photographed with Gel Documentation System (BioDocAnalyze [BDA], Biometra, Germany) (Figure 6).

Figure 6. Representative blaSHV, blaTEM and blaCTX-M genes profile of phenotypically positive isolates using multiplex polymerase chain reaction (m-PCR):- Lane M: 100 bp DNA Ladder; Lane 1: Positive control for blaSHV, blaTEM and blaCTX-M genes; Lane 2: Negative control Lane 3: blaSHV positive; Lane 4: blaTEM positive; Lane 5: blaCTX-M positive; Lane 6: blaTEM and blaCTX-M positive and Lane 7: blaSHV, blaTEM and blaCTX-M positive

Antimicrobial susceptibility profile
Bacterial isolates found to be positive for ESBL genes by m-PCR, were tested for multi drug resistance by the Kirby Bauer disk diffusion method as per Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2010) against 20 antibiotics (Table 4).

Statistical Analysis
Level of significance p<0.05 was done by analyzing data using students t-test.

Table (4):
Antibiotic resistance pattern of E. coli isolates

 
 
 
Antibiotic
ESBL E.coli  Isolates (N=158) Non ESBL E.coli
Isolates  (N=52)
P -Value
Sensitive
(S)
Resistant (R) Sensitive (S) Resistant(R)
% N % N % N % N
Amikacin 91.2 144 8.8 14 80.77 42 19.23 10 0.426
Amoxyclav 16.6 26 83.4 132 55.77 29 44.23 23 <0.01
Ampicillin 0 0 100 158 11.5 6 88.5 46 <0.01
Aztreonam 21.5 34 78.5 124 59.6 31 40.4 21 <0.01
Cefepime 0 0 100 158 55.7 29 44.3 23 <0.01
Cefixime 14.6 23 85.4 135 61.5 32 38.5 20 <0.01
Ceftriaxone 13.3 21 86.7 137 73 38 27 14 <0.01
Chloramphenicol 78.5 124 21.5 34 69.2 36 30.8 16 0.444
Ciprofloxacin 97.5 154 2.5 4 78.8 41 21.2 11 0.159
Co-Trimoxazole 41.8 66 58.2 92 42.3 22 57.7 30 0.956
Doxycycline 41.8 66 58.2 92 46.1 24 53.9 28 0.646
Furazolidone 83 131 17 27 38.5 20 61.5 32 <0.01
Gentamicin 6.3 10 93.7 148 67.3 35 32.7 17 <0.01
Imipenem 100 100 0 0 78.8 41 21.2 11 0.112
Kanamycin 67.7 107 32.3 51 61.5 32 38.5 20 0.585
Nalidixic acid 78.1 76 51.9 82 44.3 23 55.7 29 0.002
Norfloxacin 50 79 50 79 78.8 41 21.2 11 0.011
Nitrofurantoin 91.2 144 8.8 14 59.6 31 40.4 21 0.010
Streptomycin 83 131 17 27 63.5 33 36.5 19 0.107
Tetracycline 33 52 67 106 67.3 35 32.7 17 <0.01

*p value <0.05 differ significantly

RESULTS

ESBL screening of E. coli
The initial screening test of ESBL production by DDST and the phenotypic confirmation test revealed that 158(or 75%) out of the 210 E. coli isolates were positive. Multiplex PCR was performed on all 158 phenotypically verified E. coli isolates using bacterial lysate as the template. Out of 158 ESBL isolates only 124 (78.48%) isolates carried the gene/s screened for blaTEM, blaCTX-M and blaSHV genes. Isolates carrying blaSHV gene produced an amplicon of 237 bp, those carrying blaTEM showed an amplicon of 445 bp. The blaCTXM gene produced an amplicon of 593bp. The multiplex PCR assay results indicated 45.16 % blaTEM genes, 8.06% bla TEM/blaCTX-M genes, 34.16% blaCTX-M, 12.09%, blaSHV, 16.90 % blaCTX-M + blaSHV, 2.50% bla TEM + blaSHV. The overall incidence of ESBL genotypes in E. coli isolates is illustrated in Figure 7.

Figure 7. The overall incidence of ESBL genotypes in screening positive E. coli isolates

Antimicrobial susceptibility profile
In total, 124 E. coli isolates were tested for their antimicrobial resistance profile against 20 different antimicrobial agents was tested. The prevalence of antimicrobial resistance among the ESBL positive strains isolated from various clinical isolates is shown in Table 4 against twenty antimicrobial agents and interpreted as resistant and sensitive following the guidelines of Clinical Laboratory Standard Institute Laboratory Standard Institute. Zone of inhibition were measured and the susceptibility (or resistance) of each isolate was determined (Figure 8 & 9).

Figure 8. Antimicrobial sensitivity pattern of ESBL isolates against aztreonam (ATM 30µg); ceftriaxone (CRO 30µg); chloramphenicol (C 30µg); imipenem (IMP 10µg) and nalidixic acid (NA 30 µg)

Figure 9. Antimicrobial sensitivity pattern of ESBL isolates against tetracycline (TE 30µg); norfloxacin (NX 10µg); ciprofloxacin (C 5µg); streptomycin (S 10µg), furazolidone (FR 50 µg) and co-trimoxazole (COT 25µg)

DISCUSSION

Surveillance of antimicrobial resistance is very important for keeping track of community infections in order to understand how different treatment approaches affect resistance. The emergence and dissemination of resistance are due to the non-judicious use of antibiotics and the resistance develops either by intrinsic way or acquired way.11

One of the eight bacterial species WHO has singled out is E. coli and is of particular concern for antibiotic resistance, serving as a sentinel organism which is responsible for developing resistance in urine and blood.1 There are significant regional and global differences in the incidence of ESBL among clinical isolates, and these differences are evolving quickly.12 The prevalence reported in our study (75%) which is in agreement with 61% by other studies Falgenhauer et al.13; 69.2 % by Pouladfar et al.14 and 72.9% by Mood et al.15 and lower than reported by Ali et al.16 (80%) and Kokabi et al.17 (84.74%). In contrast, it is higher than those reported from Iran (26.6%) by Tabar et al.18; 34.6% by Naziri et al.19; 24.5% by Mohajeri et al. 20; 41% by Hashemizadeh et al.21 and 46.1% by Moosavian et al.22

The ESBL-positive E. coli isolates investigated here showed higher frequency of blaTEM genes (45.16%) followed by blaCTX-M (34.67%), blaSHV (12.09%) and blaTEM + blaCTX-M genes (8.06%).

Our findings are consistent with those of Cristea et al.23 who found 19.7% E. coli isolates encoded for blaSHV. Furthermore, Sadeghi et al.24 reported 38.8% isolates encoded for blaCTX-M and also Habeeb et al.25 reported 42.5% isolates and 48.1% isolates of E. coli encoded for blaCTX-M and blaTEM, respectively.

In another report by Jena et al.,26 frequency of blaTEM was reported more than blaCTX-M, followed by blaSHV which is in close conformity to our findings.

Antibiotic resistance in E. coli has been seen to rise across multiple drug classes in many investigations, and resistance to β-lactam, cephalosporin, and carbapenem antibiotics is becoming more well-documented.11,27,28,29 The ESBL production is alarming. Our study showed a susceptibility of 100% for imipenem, this frequency was similar with other studies in which susceptibility varied from 95 up to 100% for imipenem.18,20,25,30,31,36 We have few options for treating severe infections because of the significant rise in β-lactamase production, which includes the high level of ESBL producers. In this study, the ESBL strains showed high resistance to ampicillin (100%), aztreonam (78.5%), cefepime (100%), ceftriaxone (86.6%), tetracycline (66.66%), norfloxacin (50%) and nitrofurantoin (8.33%), which is consistent with a claim made by Cristea et al in Romania.23 and also observed in other studies.31-34 Most of the therapeutic problem are associated with ESBL strains due to their resistant against broad spectrum antibiotics including third generation cephalosporins. These strains also have the potential for plasmid-mediated quinolone (PMQR) and carbapenem resistance. MDR Multiple Drug Resistance is also responsible for creating complications in level of resistance leading to overprescribing of antibiotics in healthcare settings without prior microbiologic testing.35,36

CONCLUSION

The high prevalence of ESBL-producing E. coli isolates in clinical samples indicates the urgent need for appropriate infection control restrictions. The identification of blaTEM as the most prevalent gene in these isolates highlights the need for further research to determine the molecular epidemiology of ESBL-producing E. coli. The high levels of resistance to commonly used antibiotics, such as ampicillin, doxycycline, cefixime and gentamicin, underscore the importance of prudent use of antibiotics to reduce the selection pressure on resistant strains. The findings of this study provide valuable insights into the prevailing trends of ESBL-producing E. coli in the region and can help in the development of effective prevention and control strategies.

Declarations

ACKNOWLEDGMENTS
The authors would like to thank Department of Microbiology, SMSR Sharda University, Department of Microbiology, JVC SKIMS and Qadri Hematology Laboratory for providing clinical isolates. Authors are thankful to the whole team of Department of Veterinary Microbiology & Immunology, SKUAST-K for their immense help and altruistic co-operation for providing laboratory support during the research. The authors also acknowledge the support for research (consumables etc.,) provided under grant from Centre for public health UNMC, Nebraska USA to Department of Veterinary Microbiology & Immunology SKUAST-K. Authors are also thankful to the technicians and office staff of the above prestigious institutes for  their guidance and support in this project.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
HAS, MAB, DKK conceptualized the study. SF, ASY, ASH helped in research conduction and sampling. SQ, BN and AT wrote the manuscript. All authors read and approved the final manuscript for publication.

FUNDING
None.

DATA AVAILABILITY
All datasets generated or analyzed during this study are included in the manuscript.

ETHICS STATEMENT
Not applicable.

References
  1. WHO. Global Antimicrobial Resistance Surveillance System (GLASS) Report: Early Implementation 2020; WHO: Geneva, Switzerland. 2020.
  2. Ramphal R, Ambrose PG. Extended-spectrum b-lactamases and clinical outcomes: current data. Clin Infect Dis. 2006;42(Supplement 4):S164-S172.
    Crossref
  3. El Aila NA, Al Laham NA, Ayesh BM. Prevalence of extended spectrum beta lactamase and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Gram negative bacilli isolates from pediatric patient population in Gaza strip. BMC Infect Dis . 2023;23(1):99.
    Crossref
  4. Tayh G, Al Laham N, Fhoula I, et al. Frequency and Antibiotics Resistance of Extended-Spectrum Beta-Lactamase (ESBLs) Producing Escherichia coli and Klebsiella pneumoniae Isolated from Patients in Gaza Strip, Palestine. J Med Microbiol Infect Dis. 2021;9(3):133-141.
    Crossref
  5. Knothe H, Shah P, Krcmery V, Antal M, Mitsuhashi S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection. 1983;11(6):315-317.
    Crossref
  6. Sheng WH, Badal RE, Hsueh PR. Distribution of extended-spectrum b-lactamases, AmpC b-lactamases, and carbapenemases among Enterobacteriaceae isolates causing intra-abdominal infections in the Asia-Pacific region: results of the study for Monitoring Antimicrobial Resistance Trends (SMART). Antimicrob Agents Chemother. 2013;57(7):2981-2988.
    Crossref
  7. Paterson DL, Bonomo RA. Extended-spectrum ג-lactamases: a clinical update. Clin Microbiol Rev. 2005;18(4):657-686.
    Crossref
  8. Fang H, Lundberg C, Olsson-Liljequist B, et al. Molecular epidemiological analysis of Escherichia coli isolates producing extended-spectrum b-lactamases for identification of nosocomial outbreaks in Stockholm, Sweden. J Clin Microbiol. 2004;42(12):5917-5920.
    Crossref
  9. Monstein HJ, Ostholm-Balkhed ֵA, Nilsson MV, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. Apmis. 2007;115(12):1400-1408.
    Crossref
  10. Boyd DA, Tyler S, Christianson S, et al. Complete nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum beta-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Antimicrob Agents Chemother. 2004;48(10):3758-3764.
    Crossref
  11. Nabi B, Upadhyay SR, Rasool S, et al. Insight to Antibiotic Resistance Under One Health Banner – A Review. Indian Vet J. 2022;99(6):7-15.
  12. Livermore DM. beta-Lactamases in laboratory and clinical resistance. Clin Microbiol Rev. 1995;8(4):557-584.
    Crossref
  13. Falgenhauer L, Imirzalioglu C, Oppong K, et al. Detection and characterization of ESBL-producing Escherichia coli from humans and poultry in Ghana. Front Microbiol. 2019;9:3358.
    Crossref
  14. Pouladfar G, Basiratnia M, Anvarinejad M, Abbasi P, Amirmoezi F, Zare S. The antibiotic susceptibility patterns of uropathogens among children with urinary tract infection in Shiraz. Medicine. 2017;96(37):e7834.
    Crossref
  15. Mood EH, Meshkat Z, Izadi N, Rezaei M, Jamehdar SA, Nasab MN. Prevalence of quinolone resistance genes among extended-spectrum B-lactamase-producing Escherichia coli in Mashhad, Iran. Jundishapur J Microbiol. 2015;8(12):e16217.
    Crossref
  16. Ali FA. Distribution of CTX-M gene among Escherichia coli strains isolated from different clinical samples in Erbil City. Iraqi J Biotechnol. 2018;17(1):87-90.
  17. Kokabi S, Norbakhsh S, Kolahi F, Tarbiat D. Determination of antibiotic resistance pattern of extended spectrum beta-lactamase producing Escherichia coli in patients referred to hospitals and medical centers of Urmia. 3rd Science and Engineering Congress,Hamburg – Germany 2020.
  18. Tabar MM, Mirkalantari S, Amoli, RI. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran. Electron Physician. 2016;8(7):2686-2690.
    Crossref
  19. Naziri Z, Derakhshandeh A, Borchaloee AS, Poormaleknia M, Azimzadeh N. Treatment failure in urinary tract infections: a warning witness for virulent multi-drug resistant ESBL-producing Escherichia coli. Infect Drug Resist. 2020;13:1839-1850.
    Crossref
  20. Mohajeri P, Darfarin G, Farahani A. Genotyping of ESBL producing uropathogenic Escherichia coli in west of Iran. Int J Microbiol. 2014;276941.
    Crossref
  21. Hashemizadeh Z, Kalantar-Neyestanaki D, Mansouri S. Clonal relationships, antimicrobial susceptibilities, and molecular characterization of extended-spectrum beta-lactamase-producing Escherichia coli isolates from urinary tract infections and fecal samples in Southeast Iran. Revista da Sociedade Brasileira de Medicina Tropical. 2018;51(1):44-51.
    Crossref
  22. Moosavian M, Ahmadkhosravy N. Survey of CTX-M gene frequency in extended-spectrum Beta-Lactamase-Producing Enterobacteriaceae isolates using the combination disk and PCR methods in Ahvaz, Iran. Jundishapur J Microbiol. 2016;9(11)e40423.
    Crossref
  23. Cristea VC, Gheorghe I, Barbu IC, et al. Snapshot of phylogenetic groups, virulence, and resistance markers in Escherichia coli uropathogenic strains isolated from outpatients with urinary tract infections in Bucharest, Romania. BioMed Res Int. 2019;5712371.
    Crossref
  24. Sadeghi M, Sedigh Ebrahim-Saraie H, Mojtahedi A. Prevalence of ESBL and AmpC genes in E. coli isolates from urinary tract infections in the north of Iran. New Microbes New Infect. 2021;45:100947.
    Crossref
  25. Habeeb MA, Sarwar Y, Ali A, Salman M, Haque A. Rapid emergence of ESBL producers in E. coli causing urinary and wound infections in Pakistan. Pak J Med Sci. 2013;29(2):540-544.
    Crossref
  26. Jena J, Sahoo RK, Debata NK, Subudhi E. Prevalence of TEM, SHV, and CTX-M genes of extended-spectrum b-lactamase-producing Escherichia coli strains isolated from urinary tract infections in adults. 3 Biotech. 2017;7(4):244.
    Crossref
  27. Tadesse DA, Zhao S, Tong E, et al. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950-2002. Emerg Infect Dis. 2012;18(5):741-9.
    Crossref
  28. Pandit R, Awal B, Shrestha SS, Joshi G, Rijal BP, Parajuli NP. Extended-spectrum b-lactamase (ESBL) genotypes among multidrug-resistant uropathogenic Escherichia coli clinical isolates from a teaching hospital of Nepal. Interdisciplinary Perspectives on Infectious Diseases. 2020;6525826.
    Crossref
  29. Wu D, Ding Y, Yao K, Gao W, Wang Y. Antimicrobial resistance analysis of clinical Escherichia coli isolates in neonatal ward. Frontiers in Pediatrs. 2021;9:670470.
    Crossref
  30. Islam MB, Jhora ST, Yusuf MA, et al. Frequency and Antimicrobial Sensitivity Pattern of Extended Spectrum b-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from urine at a Tertiary Care Hospital. Journal of Shaheed Suhrawardy Medical College. 2012;4(1):22-25.
    Crossref
  31. Niranjan V, Malini A. Antimicrobial resistance pattern in Escherichia coli causing urinary tract infection among inpatients. Indian J Med Res. 2014;139(6):945.
  32. Guessennd N, Kacou-N’douba A, Gbonon V, et al. Prevalence and resistance profile of beta lactamase enterobacteria A Broad spectrum (ESBL) In Abidjan Cote d’Ivoire from 2005 to 2006. J Sci Pharma Biol. 2008;9:63-70.
  33. Gupta V, Rani H, Singla N, Kaistha N, Chander J. Determination of extended-spectrum b-lactamases and AmpC production in uropathogenic isolates of Escherichia coli and susceptibility to fosfomycin. J Lab Physicians. 2013;5(2):90-93.
    Crossref
  34. Elsayed TI, Ismail HA, Elgamal SA, Gad AHA. The occurrence of multidrug resistant E. coli which produce ESBL and cause urinary tract infections. J Appl Microbiol Biochem. 2017;1(2):8.
    Crossref
  35. Yandai FH, Zongo C, Moussa AM, et al. Prevalence and antimicrobial susceptibility of faecal carriage of Extended-Spectrum b-lactamase (ESBL) producing Escherichia coli at the “Hospital de la Mטre et de l’Enfant” in N’Djamena, Chad. Chad Sci J Microbiol. 2014;3(2):25-31.
  36. Hrabak J, Studentova V, Jakubu V, et al. Prevalence study on carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolates in Czech hospitals – -results from Czech Part of European Survey on Carbapenemase–Producing Enterobacteriaceae (EuSCAPE). Epidemiologie, Mikrobiologie, Imunologie. 2015;64(2):87-91.

Article Metrics

Article View: 7004

Share This Article

© The Author(s) 2023. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.