Open Access
Ajay Kumar P.1 and VinodKumar C.S.2
1Research Scholar in Microbiology, Bharathiar University, Coimbatore, India.
2Department of Microbiology, S. S. Institute of Medical Sciences and Research Centre, Davangere – 577 005, Karnataka, India.
J Pure Appl Microbiol. 2017;11(2):1061-1066
https://doi.org/10.22207/JPAM.11.2.49 | © The Author(s). 2017
Received: 20/02/2017 | Accepted: 01/05/2017 | Published: 30/06/2017
Abstract

The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) in urinary tract infection among diabetic patients have become an increasing concern for management and treatment of the patients. The aim of this study was to investigate the genotypic features of CRE strains isolated from urinary tract infection among type 2 diabetes mellitus patients. A total of 1560 diabetic patients were screened for suspected urinary tract infection. 277 Gram negative bacteria were identified by Phoenix 100 system (Becton-Dickinson, USA). These isolates were screened for their ability to produce carbapenemases by a disc diffusion test. A total of 45 CRE isolates were recovered from these Gram negative bacteria. Carbapenamase producing isolates were screened for blaSPM, blaNDM, blaIMP, blaVIM, and blaGIM genes. The PCR products were sequenced in an ABI 3500 DNA sequencer (Applied Biosystems, USA). blaIMP-1, blaIMP-8, blaNDM-1, blaNDM-2, and blaNDM-4 were the predominant genes seen among E. coli, Klebsiella pneumoniae, Citrobacter freundii, Acinetobacter baumannii and Proteus mirabilis. Colistin and Amikacin were the drug of choice and Colistin had the MIC value of  < 1mg/l and for Amikacin 62% of isolates had MIC value of < 4mg/l.  This rising trend of carbapenem resistance among Gram negative bacteria stresses the increasing importance of continuous surveillance system and stewardship of antibiotics as strategies in the overall management of diabetic patients with urinary tract infection.

Keywords

Carbapenem resistance encoding genes, Gram negative bacilli, Urinary tract infection, Type 2 diabetes mellitus.

Introduction

Urinary tract infections (UTIs) are among the most common types of infectious disease, with approximately 150–250 million cases globally per year.1-3About 40–50% of women and 5% of men will develop a UTI at least once during their lifetime.2,4 Owing to their high prevalence, UTIs are a major contributor to global antibiotic use and resistance.5-6

Urinary tract infections in diabetic patients have become a serious problem with the decisive effects on mortality rates and treatment outcome. Members of the Enterobacteriaceae are among the major causative agents of Urinary tract infection. Carbapenemase-producing Enterobacteriaceae have already been detected all over the globe, with a marked endemicity according to enzyme type. In India the prevalence of Carbapenemase-producing Enterobacteriaceae is found to be 12.3 to 22%6,7.

Carbapenem resistance can be ascribed to several enzymes encoded by resistance genes including the production of various carbapenemases: K.pneumoniae carbapenemase (KPC; Ambler class A), Verona integron–encoded metallo-b-lactamase VIM), imipenemase (IMP), New Delhi metallo-b-actamase (NDM) (all Ambler class B), and oxacilinase-48 (OXA-48; Ambler Class D).3,5,8

The study was carried out to screen and characterize carbapenem resistance encoding genes among Gram negative bacteria from Urinary Tract Infection in patients with type 2 diabetes mellitus.

Materials and Methods

From July 2011 to June 2015, a total of 1560 diabetic patients were screened for suspected urinary tract infection. 277 Gram negative bacteria were identified by conventional microbiological techniques and confirmed by Phoenix 100 system (Becton-Dickinson, USA)4,9 These isolates were screened for their ability to produce carbapenemases by a disc diffusion test, in which 10mg imipenem discs were used (Hi-Media, India)7. A total of 45 CRE isolates were recovered from these Gram negative bacteria. The MICs of eleven antibiotics, including imipenem, meropenem, ceftazidime, cefotaxime, cefuroxime, aztreonam, piperacillin-tazobactam, ciprofloxacin, amikacin, gentamicin and colistin were determined using the agar dilution method, and the results were analyzed according to the CLSI criteria of 20145,7. Quality control for the MICs was performed using the reference strains Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853.

DNA extraction and screening of carbapenem-resistance genetic markers
Bacterial genomic DNA was extracted from 1 ml of overnight cultures in Tryptic Soya Broth (Hi-Media, India) using the DNA Purification Kit (Kiagen, Germany) following the manufacturer’s instructions. The DNA extracts were quantified using NanoDrop (Thermo Fisher Scientific, Wilmington, USA) and stored in a freezer at 20°C, to be used as templates in PCRs. The following genes were screened by PCR:  blaSPM-1, blaNDM, blaIMP, blaVIM, and blaGIM10-15. The primers used in the study are depicted in the table-1. All the PCR experiments were performed in duplicate.

Table (1):
Primers used and expected amplicons

Gene
Primer sequence
Amplicon (bp)
NDM
5’ – GCAGTCGCTTCCAACGGTTTGATCGT – 3’
5’ – CTCAGTGTCGGCATCACCGAGATTGC – 3’
468
IMP
5’ – CTTGATGAAGGCGTTTATGTTCATAC – 3’
5’ – AAGAGTGATGCGTCTCCAGCTTCACT – 3’
584
VIM
5’ – ATGGTCTCATTGTCCGTGATGGTGATG – 3’
5’ – GTATAGCACGTTCGCTGACGGGACGTA– 3’
377
GIM
5’ – TGGCTAGCATCTCAACTCATTCTCATG – 3’
5’ – GATTCAGCAAGATCAATGGTGTGATC – 3’
422
SPM
5’ – ATGTCTTAGTAGCGAAAATGCTTGATG – 3’
5’ – CTTCACATTGGCATCTCCCAGATAAC – 3’
509

The expected amplicons were visualized in 1.5% agarose gel stained with ethidium bromide. The 100 bp DNA ladder was used as molecular weight standard (Life Technologies, USA). Positive controls for PCR reactions were carried out by sequencing randomly selected amplicons comprising 10% of the total reactions. The PCR products were sequenced in an ABI 3500 DNA sequencer (Applied Biosystems, USA)16.

RESULTS

Out of 1560 diabetic patients were screened for suspected urinary tract infection. 277 Gram negative bacteria were isolated; of which 45 were carbapenem resistant. The MIC value for different antibiotics of all 45 carbapenem resistant Gram negative bacteria is depicted in table 2. All the isolates were resistant to aztreonam, ceftazidime, ciprofloxacin, cefotaxime, cefuroxime, imipenem, meropenem, piperacillin-tazobactam and gentamicin. All isolates were susceptible to colistin and 62% to amikacin (Table-2). Molecular detection of carbapenem resistance encoding genes among Gram negative bacteria revealed the presence of blaSPM, blaNDMblaIMPblaVIM, and blaGIM  genes.

Table (2):
Minimum Inhibitory Concentration of Carbapenem Resistant Gram Negative Bacteria isolated from Urinary tract Infection in patients with type 2 diabetes mellitus

Isolates MIC for the antimicrobial agents in mg/L and interpretation
CXM CTX CAZ ATM MEM CIP AN COL PIP IMP GEN
E.coli-5 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-8 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-9 32 R 32 R 32 R 8 R 16 R 8 R 2 S ≥1S 32 R 16 R 8 R
E.coli-13 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-19 32 R 32 R 32 R 8 R 16 R 8 R 2 S ≥1S 32 R 16 R 8 R
E.coli-23 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-29 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-37 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-48 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-55 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 16 R 8 R
E.coli-62 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 8 R 16 R
E.coli-84 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 8 R 16 R
E.coli-86 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 8 R 16 R
E.coli-87 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 32 R 16 R
E.coli-88 32 R 32 R 32 R 8 R 16 R 8 R 2 S 1S 32 R 32 R 16 R
E.coli-89 32 R 32 R 32 R 8 R 16 R 8 R 2 S ≥1S 32 R 8 R 16 R
K.pneumoniae-6 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 32 R 16 R
K. pneumoniae-14 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 32 R 32 R
K.pneumoniae-15 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K.pneumoniae-19 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K. pneumoniae-24 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K. pneumoniae-25 16 R 32 R 16 R 16 R 8 R 2 R 4 R 0.5 S 64 S 16 R 32 R
K.pneumoniae-37 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K.pneumoniae-47 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K. pneumoniae-52 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
K. pneumoniae-53 16 R 32 R 16 R 16 R 8 R 2 R 4 R 0.5 S 64 S 16 R 32 R
C. freundii-12 16 R 16 R 16 R 16 R 8 R 2 R 32 R 0.5 S 64 S 16 R 32 R
C. freundii-17 16 R 16 R 16 R 16 R 4 R 2 R 32 R 0.5 S 64 S 16 R 32 R
C. freundii-19 16 R 16 R 16 R 16 R 4 R 2 R 32 R 0.5 S 64 S 32 R 32 R
C. freundii-25 16 R 32 R 16 R 16 R 8 R 2 R 32 R ≥0.5 S 64 S 32 R 32 R
C. freundii-29 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
C. freundii-30 16 R 16 R 16 R 16 R 4 R 2 R 32 R 0.5 S 64 S 32 R ≥16 R
A. baumanii-3 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 16 R 32 R
A. baumanii-4 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
A. baumanii-14 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
A. baumanii-20 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
A. baumanii-28 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
A. baumanii-29 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
P. mirabilis-29 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 8 R
P. mirabilis-33 16 R 16 R 16 R 16 R 8R 2 R 32 R 0.5 S 64 S 32 R 32 R
E. cloacae-11 16 R 64 R 16 R 16 R 32R 4 R 2 R 0.5 S 64 S 16 R 16 R
E. cloacae-11 16 R 64 R 16 R 16 R 32R 4R 2 R 0.5 S 64 S 16 R 32 R

I,  intermediate; R, resistant; S,  susceptible; AN, amikacin; ATM, aztreonam; CAZ, ceftazidime; CIP, ciprofloxacin; COL, colistin; CTX, cefotaxime;  CXM, cefuroxime; MEM, meropenem; TZP, piperacillin-tazobactam, GEN, Gentamicin.Interpretation according to CLSI Guidelines-2014.

On nucleotide sequence of E.coli for blaSPM, blaNDMblaIMPblaVIM, and blaGIM  genes revealed that out of 16 carbapenem resistant E.coli, 4 isolates showed the presence of blaNDM-1, 3 isolates the presence of blaIMP-1, two isolates for blaNDM-4, and one isolate each for blaVIM-24, blaNDM-2, and  blaIMP-8.  Four isolates didn’t show the presence of any genes screened (Table-3).

Nucleotide sequence of Klebsiella pneumoniae for blaSPM, blaNDM, blaIMP, blaVIM, and blaGIM genes revealed that out of 10 carbapenem resistant Klebsiella pneumoniae, three isolates showed the presence of blaNDM-1, two  isolates for blaSPM-1 , one isolate each for blaVIM-24, blaIMP-8 and  blaNDM-2.  Two isolates didn’t show the presence of any genes screened (Table-3).

Nucleotide sequence of Citrobacter freundii for blaSPM, blaNDM, blaIMP, blaVIM, and blaGIM genes revealed that out of 6 carbapenem resistant Citrobacter freundii, 2 isolates showed the presence of blaNDM-1, two  isolates showed the presence of blaNDM-2, one  isolate the presence of blaIMP-1 and blaNDM-4 , and one isolate for blaVIM-24 (Table-3).

Table (3):
Distribution of Carbapenem Resistant genes among Gram Negative Bacteria isolated from Urinary tract Infection in patients with type 2 diabetes mellitus

Isolates blaIMP blaVIM blaNDM blaSPM-1
IMP-1 IMP-8 VIM-1 VIM-24 NDM-1 NDM-2 NDM-4
E.coli 3 1 1 4 1 2
Klebsiella pneumoniae 1 1 3 1 2
Citrobacter freundii 1 1 1 2 2 1
Acinetobacter baumanii 1 1 2 3
Proteus mirabilis 1
Enterobacter cloacae

 

Similarly on Nucleotide sequence of Acinetobacter baumannii for blaSPM, blaNDMblaIMPblaVIM, and blaGIM genes revealed that out of 6 carbapenem resistant Acinetobacter baumannii, 3 isolates showed the presence of blaNDM-2,  two isolates showed the presence of blaNDM-1,  one isolate the presence of blaIMP-1 and blaVIM-1 (Table-3).

Among 2 Proteus mirabilis one isolate showed the presence of blaNDM-2 and Enterobacter cloacae did not show the presence of the any carbapenem genes evaluated (Table-3).

DISCUSSION

The prevalence of bacterial resistance to antibiotics continues to increase. Regrettably, infections caused by resistant organisms result in a tremendous morbidity and mortality worldwide. The mathematician William Foster Lloyd in 1833 published his lecture entitled “Checks to Population”.8 describing how farmers using common grazing areas for their sheep could diminish this shared resource to the subsequent disadvantage of all, while still acting in rational self-interest.8 The economist Garret Hardin later encapsulated this concept as “the tragedy of the commons”.9 A similar impasse could be said to have arisen from our use of antibiotics. In seeking to maximize benefit for individual patients, clinicians now risk reduced utility of this precious shared resource for the many.

Bacterial resistance to our antibiotic arsenal is not a new phenomenon. Indeed, multiple resistance determinants have been found in bacteria isolated from environments that have been separated from human activity for millions of years.10 However, the antimicrobial resistance crisis we currently face reflects the rapid expansion, diversification and extension of host range for a multitude of resistance determinants under selection pressure from the widespread use of antibiotics. The impact of multidrug resistance (MDR) extends into all aspects of medicine and threatens the significant progress which has been made in field of modern medicine. In past decades much emphasis has been applicably placed on MDR among Gram positive cocci and several new treatment options have become available for it. However, the threat of MDR in Gram-negative organisms has not led to a similar increase in novel therapeutics. The prevalence of carbapenem resistance in Gram negative bacilli isolated from clinical samples continues to increase globally.11,14

Carbapenems was developed in the 1980s are derivatives of thyanamycin. Imipenem and meropenem were the first members of the class, had a broad spectrum of antimicrobial activity back then, nearly all Enterobacteriaceae were susceptible to carbapenems.8,9,11,14 In the 1990s, Enterobacteriaceae started to develop resistance to cephalosporins, till then, the cephalosporins were the first-line antibiotics for these organisms. Enterobacteriaceae by acquiring extended-spectrum beta-lactamases, which inactivate those agents, became resistant to cephalosporins. Consequently, the use of cephalosporins had to be restricted, while carbapenems, which remained impervious to these enzymes, had to be used more.9 In pivotal international studies in the treatment of infections caused by strains of K pneumoniae that produced these inactivating enzymes, outcomes were better with carbapenems than with cephalosporins and fluoroquinolones.10,11,17

Currently, MBL has spread through most Gram negative bacteria, which are prevalent in community-acquired and health care-associated infections12-14. Since some MBL-producing Gram negative bacteria show low-level resistance or even sensitivity to carbapenems, the CLSI breakpoints of carbapenems among them have changed since June 2010. Imipenem breakpoints of 4mg/l (susceptible [S]), 8mg/l (intermediate [I]), and 16mg/l (resistant [R]) and meropenem breakpoints of 4mg/l (S), 8mg/l (I), and 16 mg/l (R) have moved to 1mg/l (S), 2mg/l (I), and 4mg/l (R) and 1mg/l (S), 2mg/l (I), and 4mg/l (R). In the present study all the isolates had breakpoint of > 4mg/l for meropenem and > 8mg/l for imipenem. The drug of choice for carbapenem resistance isolates was Colistin. 12 out of 45 isolates had breakpoint of 1mg/l and 33 isolates had 0.5mg/l. Amikacin was the next drug of choice for MDR Gram negative isolates. 62% of isolates were sensitive to Amikacin with the breakpoint of < 4mg/l.

In China, currently available data tend to suggest that blaNDM-1 is only present at a relatively low frequency and spreading sporadically amongst Enterobacteriaceae16,17. In the present study we demonstrated high incidence of blaNDM-1, blaNDM-2, and, blaNDM-4 among E.coli, Klebsiella pneumonia, Citrobacter freundii and Acinetobacter baumannii. No data available to compare this results from India.

This is the ûrst report of IMP-8 MBL among Enterobacteriaceae in India. IMP-8 is very uncommon in Europe, only once reported from Portugal in a Pseudomonas mendocina strain18. In contrast, IMP-8 is frequently encountered in Asia, especially in Taiwan, where IMP-8-producing Enterobacteriaceae are involved in serious infections19,20. Yan et al. reported on a case series of 37 patients with bloodstream infections caused by a large variety of IMP-8-producing Enterobacterial species including Escherichia coli, K. pneumoniae, Enterobacter cloacae and C. freundii21. In India, workers have detected blaIMP and blaVIM genes in 59% of Pseudomonas aeruginosa isolates in Chennai22 and 61.1% strains carried blaVIM and 3% carried blaIMP in Tamil Nadu23.

CONCLUSION

We report for the first time Carbapenemase producing E.coli, Klebsiella pneumonia, Citrobacter freundii, Acinetobacter baumannii, and Proteus mirabilis isolated from urinary tract infection among type 2 diabetes mellitus patient. Epidemiological control and adequate identification of carbapenemase production among these isolates will enable proper management of UTI among diabetic patients.

Declarations

ACKNOWLEDGMENTS
Authors would like to acknowledge Department of Biotechnology & microbiology, Bharathiar University for the facilities and the support.

References
  1. Ronald, A. R. et al. Urinary tract infection in adults: research priorities and strategies. Int. J. Antimicrob. Agents2001; 17:343–348.
  2. Totsika, M. et al. Uropathogenic Escherichia colimediated urinary tract infection. Curr. Drug Targets 2012; 13:1386–1399.
  3. Stamm, W. E. & Norrby, S. R. Urinary tract infections: disease panorama and challenges. J. Infect. Dis 2001; 183:(Suppl. 1), S1–S4.
  4. Barber, A. E., Norton, J. P., Spivak, A. M. & Mulvey, M. A. Urinary tract infections: current and emerging management strategies. Clin. Infect. Dis 2013; 57:719–724.
  5. Zalmanovici Trestioreanu, A., Green, H., Paul, M., Yaphe, J. & Leibovici, L. Antimicrobial agents for treating uncomplicated urinary tract infection in women. Cochrane Database of Systemetic Reviews, Issue 10. Art. No.: CD007182. http://dx.doi.org/10.1002/14651858.CD007182.pub2
  6. Costelloe, C., Metcalfe, C., Lovering, A., Mant, D. & Hay, A. D. Effect of antibiotic prescribing in primary care on antimicrobial resistance in individual patients: systematic review and meta-analysis. BMJ2010; 340:c2096.
  7. Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrob Agents Chemother. 2011; 55: 4943–4960
  8. Rahal JJ, Urban C, Horn D, et al. Class restriction of cephalosporin use to control total cephalosporin resistance in nosocomial Klebsiella. JAMA. 1998; 280: 1233–1237
  9. Paterson DL, Ko WC, Von Gottberg A, et al. International prospective study of Klebsiella pneumoniaebacteremia: implications of extended-spectrum beta-lactamase production in nosocomial Infections. Ann Intern Med. 2004; 140: 26–32.
  10. Endimiani A, Luzzaro F, Perilli M, et al. Bacteremia due to Klebsiella pneumoniaeisolates producing the TEM-52 extended-spectrum beta-lactamase: treatment outcome of patients receiving imipenem or ciprofloxacin. Clin Infect Dis. 2004; 38:243–251
  11. Livermore DM, Sefton AM, Scott GM. Properties and potential of ertapenem. J Antimicrob Chemother. 2003; 52:331–344.
  12. Bazan JA, Martin SI, Kaye KM. Newer beta-lactam antibiotics: doripenem, ceftobiprole, ceftaroline, and cefepime. Infect Dis Clin North Am. 2009; 23: 983–996.
  13. Rasmussen BA, Bush K. Carbapenem-hydrolyzing â-lactamases. Antimicrob Agents Chemother 1997; 41(2):223–232.
  14. Robledo IE, Aquino EE, Vázquez GJ. Detection of the KPC gene in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii during a PCR-based nosocomial surveillance study in Puerto Rico. Antimicrob Agents Chemother 2011; 55(6):2968–2970
  15. Livermore DM, Warner M, Mushtaq S, Doumith M, Zhang J, Woodford N. What remains against carbapenem-resistant Enterobacteriaceae? Evaluation of chloramphenicol, ciproûoxacin, colistin, fosfomycin, minocycline, nitrofurantoin, temocillin and tigecycline. Int J Antimicrob Agents 2011; 37(5):415–419.
  16. Wang, X., Liu, W., Zou, D., Li, X., Wei, X., Shang, W., et al. High rate of New Delhi metallo-beta-lactamase 1-producing bacterial infection in China. Clin. Infect. Dis. 2013; 56:161–162.
  17. Hu, L., Zhong, Q., Shang, Y., Wang, H., Ning, C., Li, Y., et al. The prevalence of carbapenemase genes and plasmid-mediated quinolone resistance determinants in carbapenem-resistant Enterobacteriaceae from ûve teaching hospitals in central China. Epidemiol. Infect. 2014; 142:1972–1977.
  18. Grundmann H, Livermore DM, Giske CG et al. Carbapenem-non-susceptible Enterobacteriaceae in Europe: conclusions from a meeting of national experts. Euro Surveill 2010; 15: pii: 19711
  19. Santos C, Caetano T, Ferreira S, Mendo S. First description of bla IMP-8 in a Pseudomonas mendocina isolated at the Hospital Infante D. Pedro, Aveiro, Portugal. Res Microbiol 2010; 161: 305–307.
  20. Liao IC, Chen HM, Wu JJ, Tsai PF, Wang LR, Yan JJ. Metallo-b-lactamase-producing Enterobacteriaceae isolates at a Taiwanese hospital:lack of distinctive phenotypes for screening. APMIS 2011; 119: 543–550.
  21. Yan JJ, Lee NY, Chen HM et al. Bloodstream infections caused by IMP-8-producing Enterobacteriaceae isolates: the need for clinical laboratory detection of metallo-b-lactamases? Eur J Clin Microbiol Infect Dis 2013; 32: 345–352.
  22. Amudhan MS, Sekar U, Kamalanathan A, Balaraman S. blaIMP and blaVIM mediated carbapenem resistance in Pseudomonas and Acinetobacter species in India. J Infect Dev Ctries. 2012; 6(11):757-62.
  23. Arunagiri K, Sekar B, Sangeetha, John J. Detection and characterization of metallo-ß-lactamases in Pseudomonas aeruginosa by phenotypic and molecular methods from clinical samples in a tertiary care hospital. W Indian Med J. 2012; 61(8):778-83.

Article Metrics

Article View: 5978

Share This Article

© The Author(s) 2017. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.