Research Article | Open Access
Nartlada Onvimol, Phanita Chankate, Yuvadee Mahakhunkijcharoen and Thareerat Kalambaheti
Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University 420/6 Ratchawithi Road, Ratchathewi, Bangkok 10400, Thailand.
J Pure Appl Microbiol. 2020;14(4):2383-2397 | Article Number: 6467
https://doi.org/10.22207/JPAM.14.4.16 | © The Author(s). 2020
Received: 10/06/2020 | Accepted: 03/12/2020 | Published: 28/12/2020
Abstract

Salmonella infection is the second most common cause of diarrhea in Thailand; however, the data on antimicrobial resistance is limited. There were137 Salmonella strains, isolated from patients and 126 strains isolated from chicken meat, collected from Nonthaburi, Thailand during 2002. The top five serotypes of patients isolates were Enteritidis (22%), Typhimurium (11%), Weltevreden (8.8%), Rissen (8%), and Choleraesuis (6.6%) while the top five serotypes of chicken meat isolates were found as follows: Schwarzengrund (11.91%), Hadar (11.11%), Rissen (8.73%), Amsterdam (7.94%), and Anatum (7.94%). Salmonella strains were most resistance to the class of antibiotics that act as inhibitor to nucleic acid synthesis such as antifolates group (Trimethoprim;SXT) and fluoroquinolones (Nalidixic acid; NA, Ciprofloxacin; CIP),while the β lactam antibiotic was more effective, i.e. the 3rd gen cephalosporin (Ceftazidime; CAZ, Cefotaxime ; CTX), Monobactam (Aztreonam; ATM) and carbapenams group (Imipenem; IMP, Meropenem; MEM). The role of class I integron element in transmission of the resistance gene was revealed by detection the gene cassette associated with a class 1 integron in plasmid preparation among 80% of the isolated strains. The gene cassettes containing resistant genes of dhfrA12 (resistant to trimethoprim) and aadA2 (resistant to streptomycin and spectinomycin), were detected more frequently in the resistant strains. These gene cassettes were likely to be transmitted via plasmid, as it could not be detected in genomic DNA.

Keywords

Salmonella Enterica, Antibiotic-resistant, Integron type 1

Introduction

Salmonella is a Gram-negative, rod-shaped, facultative anaerobic bacteria that belongs to the family Enterobacteriaceae. These bacteria comprise more than 2,500 serovars and more than 50 serogroup1. They are a medically important pathogen for humans and animals 2, and Salmonella infections can cause economic losses in animal industries 3. Salmonellosis is one of the most common foodborne diseases (FBDs) worldwide, accounting for approximately 93.8 million foodborne illnesses and 155,000 deaths per year worldwide 4. In Southeast Asia, based on data for the year 2010 from the report by FREG group 5, the leading cause of death due to FBDs in the region was S. Typhi (more than 32,000 deaths) and nontyphoidal Salmonella Enterica were also responsible for deaths due to FBD. That is, nearly 16,000 deaths occurred in the region during this time frame 6.

The primary reservoir of Salmonella is the intestinal tract of animals, particularly of poultry and swine. They are also the major reservoirs of non-Typhi serotypes of Salmonella Enterica 7, 8. The extensive use of antibiotics during the past 50 years by humans and in livestock production has led to antimicrobial resistance (AMR) among several bacterial strains associated with farm animals, and such resistance has become a global phenomenon 9. Recent update from Wikipedia; https://en.wikipedia.org/wiki/Category:Antibiotics, was categorized antibiotic into 3 groups. As shown in Table 1, the first group was  β-lactam antibiotics, the second group was Antibacteria that act as inhibitor on protein synthesis, and the third was Antibacteria that act as inhibitor on DNA and RNA synthesis.  All  β-lactam antibiotics bind to PBPs (Penicilin Binding Protein), which are essential for bacterial cell wall synthesis. PBPs are members of a subgroup of enzymes called transpeptidases.  β-lactam antibiotics were divided into 6 groups, i.e. Penicillin (Penams), Carbapenems, β-lactam combination, Cephalosporin, Monobactams.  Antibiotics in the Penicillin and Cephalosporin group were developed into 4 generations.

The MDR in Salmonella has been linked to a higher risk for hospitalization and death, and resistance to fluoroquinolones and extended-spectrum cephalosporins (ESCs) imperil the dispensation and treatment options for other severe infections 10. The recommended drugs of choice for the treatment of salmonellosis are fluoroquinolones and third-generation ESCs 11.

The major route of acquisition and transmission of a drug-resistance gene is through mobile elements, including plasmids and gene cassettes in integrons 12. Integrons, first described at the end of the 1980s, are complex mobilome  that promote the horizontal transfer of class 1 integrons inside and between bacterial species 13. Integrons were divided into four classes 14. The amino acid sequences of IntI integrases have been used as a basis for dividing integrons into “classes,” with those carrying intI1 defined as “class 1,” intI2 defined as “class 2,” and intI3 defined as “class 3.” The integrases intI1, intI2, and intI3 were first identified to be associated with mobile genetic elements, whereas IntI4 and others were identified as chromosomal integrons 15. The class 1 integron is the most prevalent, and it is also clinically important in that it is a broadly distributed integron that is found in 22%–59% of Gram-negative bacteria. These integrons include two conserved segments (5’CS and 3’CS) separated by a variable region that consists of three essential core features: 1) integrase, a member of the tyrosine recombinase family, encoded by intI, which catalyzes recombination of captured gene cassettes, 2) a primary integron-associated recombination site, attI, and 3) an integron-associated promoter, Pc, which lies between attI site and intI gene 16 , 17 , 18. The promoter (Pc), located upstream of the integration site, which is necessary for the efficient transcription and expression of gene cassettes presented in the integron 13, 19. Open reading frames are specific sites that contain a modular structure called a gene cassette 20. Gene cassettes contain zero to six genes that associate integrons to multidrug resistance (MDR) 21. The cassettes are composed of the most common antibiotic resistance genes and an integrase-specific recombination site. They can also exist as either free in a circularized form or integrated at the attI site. They are only formally part of an integron when integrated as a
cassette 19.

In Thailand, utilization of antimicrobial agents in farm animals as a feed additive is not always carried out under proper veterinarian supervision. The antibiotic pressure was selected for survival of antibiotic resistant strains, particularly MDR strains of Salmonella that have been isolated in the food chain 22, 23 , 24.This process may also increase the resistance of certain bacteria and in the level of antimicrobial residues in animal products. Class 1 integrons may be involved in MDR S. enterica that were isolated from chickens, pigs, and their products in the Thailand–Cambodia border provinces 25. Salmonella infection is the second most common cause of diarrhea in Thailand; however, data on Antimicrobial Resistance (AMR) are limited 26. Many Salmonella strains were isolated from fresh chickens bought from the market in Nonthaburi province; in addition, Salmonella isolated from patient in Bumrathnaradoon hospital in same province were obtained. The identified serotypes in each population may lead to the prediction whether Salmonella serotypes that cause human infection are derived from Salmonella serotypes found in chicken-meat or not.  The drug-resistance profile among Salmonella isolates may support the drugs of choice for medical treatments.  This study is attempted to confirm the presence of transferable genetic elements, class I integrons, and try to identify any gene cassette associated with this integron. Any identified resistance genes were likely to be widespreaded among enteric bacteria, and thus increase drug- resistant bacteria to ecosystem.

Materials and Methods

Bacterial isolation
There were 137 Salmonella strains, isolated from the patients in the routine diagnostic laboratory of Bamratnaradoon Institute in Nonthaburi, Thailand, and were contributed to the research project of Assistant Professor Yuvadee Mahakhunkijcharoen, during the year 2002. In addition, the total of 126 Salmonella strains, were isolated from fresh chicken meat bought from the open market in Nonthaburi province in 2002. All of these isolates were kindly donated to this research project by Assistant Professor Yuvadee Mahakhunkijcharoen. Salmonella colonies were subcultured from glycerol stock cultures, which were kept at −70 °C. Each strain was reconfirmed as Salmonella through a biochemical test in a microbiology lab.  The pure culture on selective media eg. MacConkey agar was inoculated to the basic enteric panel media as follows, TSI: Triple Sugar Iron Agar, LIA: Lysine Iron Agar, MIO: Motility-Indol-Ornithine Agar, Urea: Urea Agar, Citrate (Simmons): Simmons Citrate Agar.  The confirmed culture of Salmonella spp were sent to National Institute of Health (NIH), Thailand for serotyping.

Antimicrobial susceptibility testing
Salmonella isolates were examined in accordance with CLSI criteria for susceptibility to 18 antimicrobial drugs using an agar disk diffusion method 27. Antimicrobial susceptibility testing was conducted with Müeller-Hinton agar. The following antimicrobial agents were tested, of which the abbreviation name and indicated concentration of µg per disk are in parentheses.  The class of available antibiotic drugs were listed and the common drugs included in this study were indicated in Table 1. The first class was b-lactam that could bind to PBPs (Penicilin Binding Protein), which are essential for bacterial cell wall synthesis.  Ampicillin (AMP, 10) was the 3rd generation of extended spectrum included in Penicillin group.  Imipenem (IMP, 10) and meropenem (MEM, 10) were included in  Carbapenems group.  Amoxicillin–clavulanic acid (AMC, 20/10), piperacillin/tazobactam (TZP, 100/10) were in β-lactam combination group.  Ceftazidime (CAZ, 30) and cefotaxime (CTX, 30) were the third generation of Cephalosporin group, while the fourth generation, cefepime (FEP, 30), was also included in this group.  Aztreonam (ATM, 30) was included in Monobactams.  The second class was antibacterial agent that inhibit protein synthesis.  Gentamicin-aminoglycosides (CN, 10), amikacin (AK, 30) and tetracycline (TE, 30) were bound to 30S ribosomal RNA to inhibit protein synthesis. Chloramphenicol (C, 30) was peptidyltransferase that bound to 50S ribosomal RNA.  The third class was antibacterial agent that act as nucleic acid inhibitor, composed of Antifolates and Fluoroquinolones group. SXT (5), trimethoprim /sulfamethoxazole DHFR (Dihydrofolate reductase) was in Antifolates acted as inhibitor of purine metabolism,thereby inhibiting DNA and RNA synthesis.   While Norfloxacin (NOR), Nalidixic acid (NA), and Ciprofloxacin (CIP) were included in Fluoroquinolones group.

Table (1):
List of antimicrobials and the concentration of drugs used to determine inhibition zones.

Class of antibiotic Antibiotic drugs Abbrevia-tion Concentra-tion (μg/ml)
1 β-lactam antibiotics bind to PBPs
1.1 Penicillin (Penams)
Narrow
spectrum
1st gen β-lactamase sensitive
2nd gen β-lactamase resistant
Extended
spectrum
3rd gen Aminopenicillins Ampicillin AMP 10
4th gen Carboxypenicillins
1.2 Carbapenems Imipenem IMP 10
Meropenem MEM 10
1.3 β-lactam combination Amoxicillin–clavulanic acid AMC 20/10
Piperacillin/tazobactam TZP 100/10
1.4 Cephalo
sporin
1st gen Cephazolin KZ 30
2nd gen
3rd gen Ceftazidime

Cefotaxime

CAZ

CTX

30
4th gen Cefepime FEP 30
1.5 Monobactams Aztreonam ATM 30
1.6 β-lactamase inhibitors
2. Antibacterials: protein synthesis inhibitors
2.1 Binding 30S Aminoglycosides
(initiation inhibitors)
Gentamicin CN 10
Amikacin AK 30
Tetracycline antibiotics
(tRNA binding)
Tetracycline TE 30
2.2 Binding 50S Peptidyl transferase
(Amphenicols gr.) Chloramphenicol C 30
3. Antibacterials: nucleic acid inhibitors
3.1 Antifolates (inhibits purine metabolism, thereby inhibiting DNA and RNA synthesis) Trimethoprim
DHFR (Dihydrofolate reductase) inhibitor; antifolate
SXT 5
3.2 Fluoroquinolones (inhibits bacterial DNA gyrase and/or topoisomerase ) Norfloxacin NOR 10
Nalidixic acid NA 30
Ciprofloxacin CIP 5

Escherichia coli ATCC 25922 was used as a control for the susceptible strain. The Salmonella isolates with MDR were defined as having acquired non-susceptibility to at least one agent in three or more antimicrobial categories 28, 29.

Plasmid DNA extraction
Salmonella isolates were grown on TSA overnight, and bacterial cells were scraped into 5 ml of Normal Saline Solution (NSS). After centrifugation for 2 min at 10,000 rpm, the pellet was collected for further plasmid DNA extraction. Plasmid DNA was extracted with a Plasmid MiniPrep Kit (ver. 2.0; BioFact, Korea) following the manufacturer’s protocol. The purified plasmid DNA was identified with gel electrophoresis in 0.4% agarose, based on GeneRuler High Range DNA Ladder (Catalog Number SM1351, Fermentas_ThermoFisherScientific, USA), with the MW marker ranged from 10 to 48 kb, and the obtained DNA was stored at −20 °C for use in further molecular investigations.

Table (2):
Primers for the detection of class 1 integrons.

Gene Primer Oligonucleotide primer sequence 5’ to 3’; strand direction (+/-) Strand Expected size (bp) References
Integrase I enzyme intI1L ACATGTGATGGCGACGCACGA + v (varia-ble) Mazel, 2006 [24]
  intI1R ATTTCTGTCCTGGCTGGCGA    
Class I
integrons
hep58 TCATGGCTTGTTATGACTGT + v [25]
hep59 GTAGGGCTTATTATGCACGC
5ꞌCS GGCATCCAAGCAGCAAG + v Siebor, 2016 [39]
3ꞌCS AAAGCAGACTTGACCTGA

Detection of class I integrons and their associated gene cassettes
The specific integrase gene, intI1, was identified with primers described by Mazel 30. The DNA regions of class 1 integrons were screened with PCR using primers of the hep series (Table 1), as described by White 31. In addition, the primers in the 5′ and 3′ conserved regions, upstream from the class I integrons, were used as described by Ploy 32. The PCR product of any gene cassette associated with class I integrons were subjected to DNA extraction from the gel and then subjected to cloning into plasmid vector, in order to determine sequences of the inserted DNGene cloning of PCR products for DNA sequencing

PCR products of the target gene were cloned into pSC-A-amp/kan PCR cloning vectors (StrataClone PCR Cloning Kit, Agilent Technologies, USA, Canada) in accordance with the manufacturer’s protocol. Briefly, the inserted PCR product of 2 μl was ligated to 1 μl of the StrataClone Vector Mix and 3 μl of the StrataClone Cloning Buffer. The ligated product was then transformed to StrataClone SoloPack competent cells.  The PCR, based on M13 forward and M13 reversed primers, were used to screen colonies with the inserted DNA. The colonies with inserted DNA larger than 1 kb were selected for plasmid preparation, and DNA sequencing was performed using the sequencing primers of the cloning vector.

Data analysis
Microsoft Excel was used to process the descriptive data. The DNA sequence data were assembled as contigs by the SeqMan Program, DNAStar software (Lasergene 8.0, DNAStar Inc., Madison, WI, USA), and Demo Sequencher software version 4.5 (http://www.genecodes.com/sequencher-feature). The nucleotide sequences were compared online using the National Center for Biotechnology’s Basic Local Alignment Search Tool (BLAST) software.

RESULTS

Salmonella serotypes found in this study
There were 137 Salmonella strains, isolated from the patients in the routine diagnostic laboratory of Bamratnaradoon Institute in Nonthaburi, Thailand, and were contributed for this study. Likewise the 126 Salmonella strains were isolated from chicken meat collected from the markets in Nonthaburi province,Thailand during the same period of the year 2002 by Dr. Yuvadee Mahakhunkijcharoen of the Department of Microbiology and Immunology and collected as bacterial stock at the Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University. Microbiological techniques identified all Salmonella isolates as S. Enterica species, whereas serotype identification was conducted by the National Institutes of Health, Thailand. The prevalence of the serotypes among these isolates were included in the 35 serotypes, and two isolates were the non-typable strain from patients meanwhile the 29 serotypes, and one isolate was a non-typable strain from chicken meat. The top five serotypes of patients isolates were found frequently, and their percentages of incidence were as follows: Enteritidis (22%), Typhimurium (11%), Weltevreden (8.8%), Rissen (8%), and Choleraesuis (6.6%) while the top five serotypes of chicken meat isolates were found  as follows: Schwarzengrund (11.91%), Hadar (11.11%), Rissen (8.73%), Amsterdam (7.94%), and Anatum (7.94%). The other serotypes shown in Table 3 were further identified in different percentages ranging from 0.7 – 4.4% in patients isolates and 0.79% to 5.56% in chicken meat isolates.

Table (3):
Serotypes of Salmonella Enterica isolated from patients and chicken in Thailand during 2002

No. Serotypes Patients Chicken meat
Isolates (137)  (%) isolates (126) (%)
1 Enteritidis 30 22 7 5.56
2 Typhimurium 15 11 4 3.18
3 Weltevreden 12 8.8 3 2.38
4 Rissen 11 8 11 8.73
5 Choleraesuis 9 6.6
6 1,4,12:1:- 6 4.4 1 0.79
7 4,1:i:- 4 2.9
8 Hadar 4 2.9 14 11.11
9 Panama 4 2.9 3 2.38
10 Albany 3 2.2 5 3.97
11 Brandenrup 3 2.2
12 Lexington 3 2.2 1 0.79
13 Stanley 3 2.2 5 3.97
14 4,5,12:i:- 2 1.5
15 Agona 2 1.5 3 2.38
16 Amsterdam 2 1.5 10 7.94
17 Cerro 2 1.5
18 Schwarzengrund 2 1.5 15 11.91
19 Virchow 2 1.5 7 5.56
20 4,5,12,i:- 1 0.7
21 4,12:i:- 1 0.7
22 Anatum 1 0.7 10 7.94
23 Mbandaka 1 0.7 2 1.59
24 Dublin 1 0.7
25 Heidelberg 1 0.7
26 Hvittingfoss 1 0.7
27 Isangi 1 0.7
28 Javiana 1 0.7
29 Kentucky 1 0.7 2 1.59
30 Newport 1 0.7 1 0.79
31 Orion 1 0.7 2 1.59
32 Pakistan 1 0.7
33 Paratyphi B var Java 1 0.7
34 Saintpaul 1 0.7 3 2.38
35 Thomson 1 0.7
36 Blockley 4 3.18
37 Chester 2 1.59
38 Emek 2 1.59
39 Give 2 1.59
40 Senftenberg 2 1.59
41 Bovismorbificans 2 1.59
42 Derby 1 0.79
43 Krefeld 1 0.79
44 Sandiego 1 0.79
45 unknown 2 1.5 1 0.79

Multi Drug Resistance (MDR) profiles of Salmonella isolates
A total of 137 and 126 Salmonella strains that, isolated from patients and chickens respectively were analyzed, and their resistance to 18 antibiotics were determined with a disk diffusion assay. Among Salmonella isolates from patients, 69.34% were resistant to antibiotics and 10.95% were susceptible to antibiotics, while among chicken meat- isolates, 86.5% were resistant to antibiotics and 13.5% were susceptible to antibiotics. The growth of Salmonella strains was partially inhibited by some antibiotic drugs and these cases were assigned as having intermediate effect, of which 19.7% were found in Salmonella isolates from patients and 12.7% of Salmonella isolates from chicken.

As summarized in Table 4, based on the mode of action of antibiotic, that were divided into 3 classes based on their action as inhibitor on 3 metabolic pathway; cell wall synthesis, protein synthesis and function of nucleic acid.  Among Salmonella strains isolated from patients, 65.8% were mostly resistant to antibiotics that act as nucleic acid inhibitor, i.e. 30% were resisted to antifolates group of trimethoprim (SXT), while among fluoroquinolones group; 29.2% were resistant to nalidixic acid (NA), 4.4% were resistant to ciprofloxacin (CIP) and 2.2% were resistant to norfloxacin (NOR).

Table (4):
Percentage of Salmonella strains, isolated from human and chicken meat, that resisted to different classes of antibiotic based on disk diffusion assay.

Class of antibiotics based on mode of action cell wall synthesis
inhibitord
(β-lactam)
Protein Synthesis
inhibitor
Nucleic acid inhibitors
Penicillin β-lactam combination Cephalosporin Monobactams Aminoglycosides Tetra
cycline
Peptidyl transferase Antifolates Fluoroquinolones
AMP AMC TZP KZ CTX ATM CN AK TE C SXT NOR NA CIP
Source H C H C H C H C H C H C H C H C H C H C H C H C H C H C
No. of resistant isolates 62 36 3 2 2 0 11 12 1 0 0 2 17 7 0 1 39 64 28 23 41 34 3 0 40 73 6 2
Percentage (%) of incidence 45.3 28.6 2.2 1.6 1.5 0 8 9.5 0.7 0 0 5.6 12.4 5.6 0 0.8 28.5 51 20.4 18.3 30 27 2.2 0 29.2 58 4.4 1.6
%Total for human 57.7 61.3 65.8
%Total for chicken meat 41.3 75.7 86.6

Sources  H= Human (126 isolates) ; C= Chicken meat (137 isolates)

The second rank of resistant drugs were included in group of protein synthesis inhibitors, of which 61.3% of Salmonella isolates were resistant to the following drugs, i.e. 28.5% were resisted to tetracycline (TE), 20.4% were resisted to peptidyl transferase group of chloramphenicol (C) and 12.4% were resisted to aminoglycosides group of gentamicin (CN) . For the group of cell wall synthesis inhibitors, 57.7% of Salmonella strains were resistant to β lactam antibiotic or, including 45.3% were resisted to penicillin group of ampicillin (AMP).  For cephalosporin group, 8% were resisted to cefazolin (KZ);1st gen cephalosporin; and 0.7% were resisted to cefotaxime (CTX) of which included in the 3rd gen cephalosporin. The Samonella isolates of 2.2% and 1.5% were resisted to amoxicillin–clavulanic acid (AMC) and piperacillin/tazobactam (TZP) of β-lactam combination group.

Among Salmonella strains isolated from chicken meat, 86.6% of them were mostly resistant to antibiotics that act as nucleic acid inhibitor, i.e. 27% were resisted to antifolates group of SXT (trimethoprim), while among fluoroquinolones group; 58% were resistant to nalidixic acid (NA) and 1.6% were resistant to ciprofloxacin (CIP). The second rank of resistant drugs were included in group of protein synthesis inhibitors, of which 75.7% of Salmonella isolates were resistant to the following drugs, i.e. 51% were resisted to tetracycline, and 18.3% were resisted to chloramphenicol (C).  In addition, few strains were resistant to aminoglycoside drug, i.e. 0.8% and 5.6% to amikacin (AK) and CN (gentamycin) respectively.  There were 41.3% of Salmonella strains that resistant to β lactam antibiotic or a group of cell wall synthesis inhibitors, including 28.6% were resisted to ampicillin, 1.6% was resisted to Amoxicillin–clavulanic acid (AMC) of β-lactam combination class, 9.5% were resisted to cephazolin (KZ) of cephalosporin group and 1.6% was resisted to aztreonam (ATM) of monobactams group.  All Salmonella isolates were susceptible to Ceftazidime (CAZ), of which included in the 3rd gen cephalosporin. In addition, they all susceptible to carbapenems drug, including Imipenem (IMP) and Meropenem (MEM).

In summary, as shown in Table 4, we found that Salmonella strains were most resistance to the class of antibiotics that act as nucleic acid inhibitors such as antifolates group (SXT) and fluoroquinolones (NA, CIP), and the moderate resistance was also found among the drug that act as inhibitor to nucleic acid synthesis, while the β lactam antibiotic seem to be more effective in treatment. All Salmonella isolates of that time were susceptible to Ceftazidime (CAZ), the 3rd gen cephalosporin and carbapenems drug.

In this study, Salmonella strains that were resistant to more than 3 classes of antibiotics demonstrating as multidrug resistance (MDR). For patient and chicken meat isolates, there were 74 (54.02%) and 45 (36%) isolates showed multidrug resistance, of which were varied from 3 to 7 drugs.  The MDR pattern can be divided into 47 and 37 profiles in patient and chicken meat – isolates respectively, data shown in Supplement Table 1. The drug resistant profile of 3 drugs and 4 drugs patterns were mostly found in 33 (24.1%) and 19 (14%) of Salmonella isolates from patients, while chicken meat were found in 19 (15.1%) and 15 (11.9%) isolates respectively. Furthermore, the MDR profile of 5 and 6 drugs patterns were found in 12 (8.8%) and 9 (6.7%) of Salmonella isolates from patient, while in chicken meat were found as 8 (6.4%) and 2 (1.6%) respectively (Table 5). Lastly, the MDR profile of 7 drugs found only in 2 isolates (1.5%) of serotype Schwarzengrund and 4,12:i:- from the patient, while only in 1 isolate (0.8%) of serotype Albany was from chicken meat.

Table (5):
Number of Salmonella strains from patients and chicken meat in Thailand resisted to antibiotics.

 
Antibiotics
Patients Chicken
Number of Isolate(s) Percent (%) Number of Isolate(s) Percent (%)
multidrug resistance
7 2 1.46 1 0.79
6 9 6.57 2 1.59
5 12 8.76 9 7.14
4 19 13.87 14 11.11
3 32 23.36 19 15.1
total 74 54.02 45 35.73
resistance to one or two drugs
2 13 9.49 35 27.78
1 18 13.14 29 23.02
total 31 22.63 64 50.79
susceptible/intermediate
total 32 23.36 17 13.49
Total number of

isolates

137 100 126 100

The strains, resistant to 1-2 drugs of different patterns were shown in Supplement Table 1.  Among isolates from patients, the resistant profile to 1 antibiotic were detected in 18  isolates (13.14%) and most were presented as resistant to NA (17 isolates) while resistant profile to 2 antibiotics was detected in 13  isolates (9.5%). Among isolates from chicken meat, the resistant profile to 1 antibiotic was detected in 29 isolates (23.02%)  and mostly were presented as resistance to NA (17 isolates) as were frequently observed in serovar Amsterdam while resistant profile to 2 antibiotics was detected in 35 isolates (27.78%). The most prevalence was resistance to in NA and TE (22 isolates) and were frequently observed in serovar Hadar.

Identification of integron class 1 from Salmonella plasmids
Plasmids were extracted from all Salmonella Enterica isolates as DNA templates, and their sizes were larger than 20 kb, based on a high-range DNA marker (Fermantas; Thermofisher, USA). The detection of the integron 1 platform was performed using primers derived from the 5′ and 3′ conserved regions. A single band or a few bands were observed among the isolates, and the sizes of the PCR products were ranged from 0.5 kb to 3 kb. PCR products could be detected in 102 of the 126 Salmonella isolates (80.95%). When the primers that used to detect the integron I part was used to amplify genomic DNA as template, no product was detected, suggesting that the integron I part was presented in plasmid only.   Some selected PCR products obtained from integron I units that were larger than 0.8 kb were purified and cloned into TA cloning vectors (Stratagene, USA) to identify any antibiotic resistance genes that could be associated with the integron I unit. The plasmids with the inserted gene were sequenced.

Table (6):
Gene cassettes associated with integron 1 found in plasmids of Salmonella Enterica, isolated from human and chicken meat.

Strains_Serotype
Host
Size (bp)
Resistance – Pattern
Accession no
Identified genes and proposed function
7-14_ Typhimurium
human
1932
AMP, CN, TE, SXT, NA
MT 884062
-DhfrXII ;Dihydrofolate reductase; confer resistance to trimethoprim-AddA2 ;Streptomycin 3′ adenyltransferase; confer
resistance to streptomycin and spectinomycin
24-7_ Typhimurium
human
1932
AMP, CN, TE, C , SXT, NA
MT
936291
Same profile as strain 7-14
13-3_ Stanley
human
1931
AMP, TE, C, SXT
MT
911987
Same profile as strain 7-14
18-2_ Stanley
human
1932
TE, C ,SXT
MT
911988
Same profile as strain 7-14
36-6_ I,1,4,12:i:-
human
1932
AMP, CN, TE, C , SXT, NA
MT
993752
Same profile as strain 7-14
70-3_ I,1,4,12:i:-
human
1932
AMP, TE, SXT, NA
MT
993753
Same profile as strain 7-14
72-1_ Albany
human
1228
AMP, SXT
MT
993759
blaPSE-1; PSE-1 beta-lactamase
83-1 _ Schwarzengrund
human
1216
AMP, KZ, CN, TE,C, SXT,  NOR
MW
008868
blaCARB-2; PSE family carbenicillin-hydrolyzing class A beta-lactamase
96-6_ Rissen
human
1932
SXT, NA
MW
008869
Same profile as strain 7-14
NIH20-9 _Rissen
human
1933
AMP, KZ, SXT, TE, CN
MW
075229
Same profile as strain 7-14
101-5 _Anatum
human
1932
AMP, SXT
MW
013510
Same profile as strain 7-14
108_2_ Agona
human
1934
TE, C, SXT, NA
MW
023089
Same profile as strain 7-14
NIH18-2_ Agona
human
1933
AMP, SXT, KZ, CTX, CAZ, FEP,  ATM, TE, CN,C
MW
059029
Same profile as strain 7-14
119-2_ Cholerasuis
human
1932
AMP, TE, NA
MW
030628
Same profile as strain 7-14
90-15_ Senftenberg
Chicken meat
1931
AMP, TE, SXT, NA
MW
075230
Same profile as strain 7-14

Although PCR product associated with integron type I were detected in most Salmonella isolates, the gene cassettes of PCR product larger than 1.5 kb were selected to clone into PCR cloning kit containing T-tailed plasmid vector.  The PCR inserted of 1932 bp was successfully cloned and sequenced from the following serotypes; 2 strains, 7-14 and 24-7 of serotype Typhimurium; strain 13-3 and 18-2 of serotype Stanley; strain 36-6 and 70-3 of serotype  I,1,4,12:i:-; strain 96-6 and NIH20-9 of serotype Rissen; strain 108-2 and NIH18-2 of serotype Agona; strain 119-2 of serotype Cholerasuis and strain 72-1 of serotype Albany and lastly, strain 101-5 of serotype Anatum.  These gene cassette of 1932 bp insert, contained 2 complete open reading frames; 498 bp of dhfrXII; dihydrofolate reductase that confer resistance to trimethoprim (SXT) and 792 bp of streptomycin 3’ adenyltransferase that confer rsistance to streptomycin and spectinomycin. The integron cassette from all of these Salmonella serovars were similar to the Aeromonas hydrophila strain EG9 with 99%–100% similarity, of which the sequence was deposited in GenBank with accession no. KF442255.1. Most of the Salmonella strains, that possessed the gene cassette of dihydrofolate reductase could resist to SXT drug, except for the strain 119-2 of serotype Cholerasuis.

Furthermore, strain no. 72-1 of serotype Albany and strain 83-1 of serotype Schwarzengrund contained insert size of approximately 1200 bp, that was similar to blaCARB-2 gene, which codes for carbenicillin-hydrolyzing β-lactamases (also named CARB enzymes) that was first identified from Pseudomonas aeruginosa 33. The blaCARB genes are narrow-spectrum class A penicillinases and are known to be widespread among distantly related bacteria, including Vibrio spp. and Salmonella 34. Their location on mobile genetic elements as a form of gene cassettes of class 1 integrons, confirmed the widespread of this element.

DISCUSSION

Prevalence of Salmonella serovars
In this study, during 2002, the top five serotypes of patients isolates were found frequently, and their percentages of incidence were as follows: Enteritidis (22%), Typhimuriumb (11%), Weltevreden (8.8%), Rissen (8%), and Choleraesuis (6.6%). The human specimens were derived from varied sources such as feces, urine, blood etc.    During 2011-2013 in Siriraj Hospital, Bangkok, Thailand, the available blood isolates were identified as Salmonella Choleraesuis (34.2%) was the most common serotype, and S. Enteritidis (31.5%) ranked second, accounting for 65.8% of all isolates 35Salmonella isolates, identified during the year 2002, also had the majority as Enteritidis (22%), although the less number of Cholerasuis (6.6%) were found in that earlier time point.

There were 126 Salmonella strains, isolated from chicken meat collected from markets around Nonthaburi province of Thailand in 2002. These Salmonella population composed of 26 serovars, of which most common serovars, included Schwarzengrund (11.9%), Hadar (11.1%), Rissen (8.7%), Amsterdam (7.9%), and Anatum (7.9%). Most serovars found in chicken were able to infect human, as they are also found to infect paients  in this study. The results are consistent with the study of Salmonella prevalence in chicken meat from markets in Bangkok and the central region of Thailand in 2015, which mostly included serovar Schwarzengrund 36. As with the report from samples collected in five provinces in northeastern Thailand during 2010–2013, the diversity of Salmonella isolates from chickens included 17 serovars, and the most common serovars were Schwarzengrund (23.8%) and Rissen (16.3%) 37. Furthermore, between 1993 and 1994, Boonmar 38 found S. enteritidis most frequently, both in samples isolated from frozen chicken in the northeast and from people in Bangkok, Thailand.

Antibiotic resistance of Salmonella isolates
This study in 2002, the most resistant drugs were NA (fluoroquinolones); that was found in 58% of the Salmonella isolates, TET in 51% and AMP (β lactam) in 28.6% of the Salmonella isolates. In Khon Kaen, northeast Thailand, Among Salmonella isolated from human patients,pork and chicken meat, the percentages that were resistant to TET were 92.6%, 88.5%, and 100%, respectively 22. Likewise, during 2003–2005 in Bangkok, the resistance to TET was observed most often in Salmonella isolated from swine. Among the isolates from poultry, the highest frequencies of resistance were resistant to AMP and TET 39. Among the nucleic acid inhibitor drug, Salmonella isolates from human, were quite resist to Antifolate drug; SXT (30%) and also resist to Fluoroquinolone drug; NA at 29%, the drug of choice for Fluoroquinolone drug were NOR and CIP that were resistant at 2.2 and 4.4% respectively.  Among b-lactam antibiotic, Salmonella isolates were quite resistant to Ampicilin (45%), while they were all susceptible to Carbapenems group (IMP, MEM). In β-lactam combination group, Salmonella were resistant to AMC and TZP at 2.2 and 1.5% respectively, then could be the drug of choice for treatment.  Lastly, Cephalosporin group (CAZ, CTX) were effective drug, as Salmonella has less percentage of resistance.  In this study, only 0.7% of Salmonella- human isolates were resistant to CTX, while isolates from Siriraj Hospital had 15.2% resistance to CTX 35.

Prevalence of class 1 integrons
In our study, the plasmids that were extracted from 126 S. Enterica isolates and the gene cassettes associated with the class 1 integron region were detected in 80.95% of the isolated strains when analyzed with primer pair 3’CS–5’CS. The integrase 1 (IntI1) gene was detected in the genomic DNA of all Salmonella isolates, whereas the detection of integron cassettes were only found in plasmid, suggesting the transmission of MDR cassettes via the plasmids. Several reports indicated that class 1 integrons, such as Miko 9, was the most prevalent, and class 1 integrons were detected in 65% of the multidrug-resistant Salmonella isolates, comprising 16 different serovars. Van 40 found class 1 integrons in 76% and 43% of the E. coli and Salmonella isolates, respectively. Similarly, Sinwat 37 found that 41% of the Salmonella isolates were positive for intI1, of which 60% carried class 1 integrons. These reports emphasize the important role of class 1 integrons in the dissemination of drug-resistant genes.

We mostly focused on Salmonella strains that had the size of PCR products in the range of approximately 1 kb to 2 kb, in accordance with previous reports 37, 41-43. PCR fragments were purified and cloned into plasmid vectors and then sequenced using the primers of the vector. DNA sequences were analyzed with BLAST to find its homologue. In this study, the gene cassettes dhfrA12 and aadA2 were identified in the MDR strains of serovars Typhimurium, Stanley, I,1,4,12:i:-, Rissen, Anatum, Agona, Cholerasuis, Senftenberg, while they were also had STX – resistant profile. Strain 96-6 of serovars Rissen  and strain 101-5 of serotype Anatum were both possessed the same gene cassettes of dhfrA12 and aadA2, and they were also resistant to STX and another drug.  Strain no. 72-1 of serotype Albany and strain 83-1 of serotype Schwarzengrund possessed the PSE-1 beta-lactamase gene associated to integron type I, while they both also were resistant to Ampicilin drug. The presence of integron associated – resistant gene may then influence drug-resistant profile of bacteria.

A few types of drug-resistance genes associated with integron I were reported to exist among the Salmonella isolates of Thailand. In Bangkok, during 2003–2005, Khemtong 42 reported that the intI1 gene was presented in 54 isolates and 33 carried gene cassettes with sizes ranging from 0.7 to 2.3 kb. The sequence analysis showed that resistance genes, including blaPSE-1, dfrA1, dfrA12, aadA2, aadA4a, and silB, were presented and the gene cassette array dfrA12– was the most prevalent among the isolates in serovars Kentucky, Anatum, Stanley, Eppendorf, Typhimurium, Rissen, Schwarzengrund, and Weltevreden. In addition, these genes were located in the plasmids and were successfully transferred to other bacterial isolates from Khemtong 42.

In recent decades, class 1 integrons are known to play a major role in the acquisition and dissemination of AMR through horizontal transmission to the spread of antibiotic resistance genes in Gram-negative bacteria 44 , 45. Most dfr genes are found to reside in gene cassettes within the variable parts of integrons, which has resulted in the rapid spread of SXT resistance in various bacteria. In Thailand, Sinwat 37 detected the dfrA12aadA2 cassette from class 1 integrons in 66.7% of Salmonella isolates in pork. Likewise, in this study, dfrA12 and aadA2 genes were frequently detected, which suggested that SXT and Str/spectinomycin resistance genes could spread among enteric bacteria. This study reveals that class 1 integrons may play a role in the acquisition and dissemination of AMR through the horizontal transmission and spread of antibiotic resistance genes among Salmonella serovars within the food chain. The antibiotic drug; SXT and Str/spectinomycin should not be effective as the resistance genes to these drugs were likely to be widely spread among Gram-negative bacteria.

SUPPLEMENTARY INFORMATION

Additional file: Additional Table S1.

Declarations

ACKNOWLEDGMENTS
We would like to thank National Institute of Health (NIH) Thailand, for their service to determine serotype among Salmonella isolates.  The staffs in Dept. of Microbiology and Immnunology, Faculty of Tropical Medicine, for maintaining the clean and well-equipted facility.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
All authors designed the experiments. YM, PC, and NO performed the experiments. NO and TK analysed  the data. NO and TK drafted the manuscript, compiled information from the literature, and designed the figures and tables. All authors read and approved the manuscript.

FUNDING
Funding was received for a PhD student’s project from the Faculty of Tropical Medicine, Mahidol University. The president of Suan Dusit University granted a scholarship for a PhD student to be the major investigator of this study.

ETHICS STATEMENT
Research on human specimens were previously collected, that were non-identifiable was exempted by Faculty of Tropical Medicine, Ethical Committee; TMEC  18-063

AVAILABILITY OF DATA
The serotype of each isolate and its drug resistant profile was included in Supplement Table 1.  The DNA sequences of identified gene associated with integron type I for each isolate was deposited in NCBI of which its accession was included in Table 6.

References
  1. Grimont P, Weill F. Antigenic formulae of the Salmonella serovars. In 9th ed. Paris, France: WHO Collaborating Centre for Reference and Research on Salmonella, Institute Pasteur; 2007.
  2. Popoff MY, Le Minor L. Salmonella. In: Brenner DJ, Kreig NR, Staley JT, editors. Bergey’s Manual of Systematic Bacteriology. New York, USA: Springer; 2005.
  3. Rushton J. The economics of animal health and production: MPG Books Ltd, Bodmin.; 2009.
    Crossref
  4. Eng S-K, Pusparajah P, Ab Mutalib N-S, Ser H-L, Chan K-G, Lee L-H. Salmonella: a review on pathogenesis, epidemiology and antibiotic resistance. Front Life Sci. 2015;8(3):284-293.
    Crossref
  5. FERG G. World Health Organization Estimates of the Global Burden of Foodborne Disease. PLOS Collections. In: WHO Library Cataloguing-in-Publication Data; 2015.
  6. Havelaar AH, Kirk MD, Torgerson PR, Gibb HJ, Hald T, Lake RJ, et al. World Health Organization global estimates and regional comparisons of the burden of foodborne disease in 2010. PLoS Med 2015;12(12):e1001923.
    Crossref
  7. Nwabor OF, Dickson ID, Ajibo QC. Epidemiology of Salmonella and Salmonellosis. Int Letters Nat Sci. 2015;47:54-73.
    Crossref
  8. Heredia N, García SJAn. Animals as sources of food-borne pathogens: A review. Anim. Nutr. 2018;4(3):250-255.
    Crossref
  9. Miko A, Pries K, Schroeter A, Helmuth R. Molecular mechanisms of resistance in multidrug-resistant serovars of Salmonella enterica isolated from foods in Germany. Antimicrobial Agents Ch. 2005;56(6):1025-1033.
    Crossref
  10. Crump JA, Medalla FM, Joyce KW, Krueger AL, Hoekstra RM, Whichard JM, et al. Antimicrobial resistance among invasive nontyphoidal Salmonella enterica isolates in the United States: National Antimicrobial Resistance Monitoring System, 1996 to 2007 Emerging Infections Program NARMS Working Group Antimicrob agents Ch. 2011;55(3):1148-1154.
    Crossref
  11. Parry CM, Threlfall E. Antimicrobial resistance in typhoidal and nontyphoidal salmonellae. Curr Opin Infect Dis. 2008;21(5):531-538.
    Crossref
  12. Recchia GD, Hall RM. Gene cassettes: a new class of mobile element. Microbiolo. 1995;141(12):3015-3027.
    Crossref
  13. Domingues S, da Silva GJ, Nielsen KM. Integrons: vehicles and pathways for horizontal dissemination in bacteria. Mob Genet Elements 2012;2(5):211-223.
    Crossref
  14. Sandvang D, Aarestrup FM, Jensen LB. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol lett. 1998;160(1):37-41.
    Crossref
  15. Deng Y, Bao X, Ji L, Chen L, Liu J, Miao J, et al. Resistance integrons: class 1, 2 and 3 integrons. Ann Clin Microbiol Antimicrob 2015;14:45-45.
    Crossref
  16. Boucher Y, Labbate M, Koenig J, Stokes H. Integrons:mobilizable platforms that promote genetic diversity in bacteria. . Trends Microbiol 2007;15:301-309.
    Crossref
  17. Messier N, Roy P. Integron integrases possess a unique additional domain necessary for activity. . J Bacteriol 2001;183:6699-6706.
    Crossref
  18. Jove T, Da Re S, Denis F, Mazel D, Ploy M. Inverse correlation between promoter strength and excision activity in class 1 integrons. PLoS Genet 2010;6:e1000793.
    Crossref
  19. Hall RM, Collis CM. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol. 1995;15(4):593-600.
    Crossref
  20. Labbate M, Case RJ, Stokes HW. The integron/gene cassette system: an active player in bacterial adaptation. Methods Mol Biol 2009;532:103-125.
    Crossref
  21. Leverstein-van Hall MA, M. Blok HE, T. Donders AR, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187(2):251-259.
    Crossref
  22. Angkititrakul S, Chomvarin C, Chaita T, Kanistanon K, Waethewutajarn S. Epidemiology of antimicrobial resistance in Salmonella isolated from pork, chicken meat and humans in Thailand. S E Asian J Trop Med. 2005;36(6):1510.
  23. Padungtod P, Kaneene JB. Salmonella in food animals and humans in northern Thailand. Int J Food Microbiol. 2006;108(3):346-354.
    Crossref
  24. Chuanchuen R, Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. J Vet Med Sci. 2009;71(10):1349-1355.
    Crossref
  25. Trongjit S, Angkititrakul S, Tuttle RE, Poungseree J, Padungtod P, Chuanchuen RJM, et al. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand-Cambodia border provinces. Microbiolo Immunolo. 2017;61(1):23-33.
    Crossref
  26. Utrarachkij F, Nakajima C, Siripanichgon K, Changkaew K, Thongpanich Y, Pornraungwong S, et al. Genetic diversity and antimicrobial resistance pattern of Salmonella enterica serovar Enteritidis clinical isolates in Thailand. J Infect Chemother 2016;22(4):209-215.
    Crossref
  27. Wayne P. Clinical and Laboratory Standards Institute; Performance Standards for Antimicrobial Susceptibility Testing. CLSI supplement M100. . 29th ed. Pensylvania, USA: Clinical and Laboratory Standards Institute; 2018.
  28. Wasfy MO, Frenck R, Ismail TF, Mansour H, Malone JL, Mahoney FJ. Trends of multiple-drug resistance among Salmonella serotype Typhi isolates during a 14-year period in Egypt. Clin Infect Dis. 2002;35(10):1265-1268.
    Crossref
  29. Magiorakos AP, Srinivasan A, Carey R, Carmeli Y, Falagas M, Giske C, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbioloy. 2012;18(3):268-281.
    Crossref
  30. Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiolo 2006;4:608-620.
    Crossref
  31. White PA, McIver CJ, Deng Y-M, Rawlinson WD. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiolo Lett. 2000;182(2):265-269.
    Crossref
  32. Ploy M-C, Denis F, Courvalin P, Lambert T. Molecular Characterization of Integrons inAcinetobacter baumannii: Description of a Hybrid Class 2 Integron. Antimicrob Agents Ch. 2000;44(10):2684-2688.
    Crossref
  33. Williams RJ, Livermore DM, Lindridge MA, Said AA, Williams JD. Mechanisms of beta-lactam resistance in British isolates of Pseudomonas aeruginosa. . J Med Microbiolo. 1984; 17 (3):283-294.
    Crossref
  34. Potron A, Poirel L, Croizé J, Chanteperdrix V, Nordmann P. Genetic and biochemical characterization of the first extended-spectrum Carb-type ss-lactamase, RTG-4, from Acinetobacter baumannii. J Antimicrobial agents chemotherapy 2009;53(7):3010-3016.
    Crossref
  35. Tribuddharat C, Pongpech P, Srifuengfung S, Meethai C. Prevalence and drug susceptibility of Salmonella isolated from patients in Bangkok, Thailand. Journal of Global Antimicrobial Resistance 2016;6:162-164.
    Crossref
  36. Niyomdecha N, Mungkornkaew N, Samosornsuk W. Serotypes and antimicrobial resistance of Salmonella enterica isolated from pork, chicken meat and lettuce, Bangkok and Central Thailand. SE Asian J Trop Med Pub Health 2016;47(1):31-39.
  37. Sinwat N, Angkittitrakul S, Chuanchuen R. Characterization of antimicrobial resistance in Salmonella enterica isolated from pork, chicken meat, and humans in northeastern Thailand. Foodborne Patho and Dis. 2015;12(9):759-765.
    Crossref
  38. Boonmar S, Bangtrakulnonth A, Pornruangwong S, Samosornsuk S, Kaneko K-i, Ogawa M. Significant increase in antibiotic resistance of Salmonella isolates from human beings and chicken meat in Thailand. Vet Microbiol. 1998;62(1):73-80.
    Crossref
  39. Chuanchuen R, Pathanasophon P, Khemtong S, Wannaprasat W, Padungtod P. Susceptibilities to antimicrobials and disinfectants in Salmonella isolates obtained from poultry and swine in Thailand. J Vet Med Sci. 2008;70(6):595-601.
    Crossref
  40. Van TTH, Moutafis G, Istivan T, Tran LT, Coloe PJ. Detection of Salmonella spp. in retail raw food samples from Vietnam and characterization of their antibiotic resistance. J Appl. Environ. Microbiol. 2007;73(21):6885-6890.
    Crossref
  41. Hsu S-C, Chiu T-H, Pang J-C, Hsuan-Yuan C-H, Chang G-N, Tsen H-Y. Characterisation of antimicrobial resistance patterns and class 1 integrons among Escherichia coli and Salmonella enterica serovar Choleraesuis strains isolated from humans and swine in Taiwan. Int J Antimicrob Agents. 2006;27(5):383-391.
    Crossref
  42. Khemtong S, Chuanchuen R. Class 1 integrons and Salmonella genomic island 1 among Salmonella enterica isolated from poultry and swine. Microb Drug Resist. 2008;14(1):65-70.
    Crossref
  43. Thong KL, Modarressi S. Antimicrobial resistant genes associated with Salmonella from retail meats and street foods. Food Res Int. 2011;44(9):2641-2646.
    Crossref
  44. Carattoli A. Plasmid-mediated antimicrobial resistance in Salmonella enterica. Curr Issues Mol Biolo. 2003;5(4):113-122.
  45. Poirel L, Carrer A, Pitout JD, Nordmann P. Integron mobilization unit as a source of mobility of antibiotic resistance genes. J Antimicrobial agents chemotherapy 2009;53(6):2492-2498.
    Crossref

Article Metrics

Article View: 3915

Share This Article

© The Author(s) 2020. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.