Collection of Samples
The Arabian Sea water samples were collected from Tithal (Valsad), Diu, Daman and Dandi beaches located on the coast of Arabian Sea of India. The details of sampling conditions during collection of seawater samples are described in Table 1. The water samples (approximately 20 ml) were collected in sterilized bottles as mentioned in Scoop method and stored at low temperature until the isolation of the bacteria was carried out (within 48 hours)⁸.

Table (1):
Sampling conditions during collection of Arabian Sea water samples.

Isolation of pigment-producing bacteria
The Arabian Sea water samples were diluted serially and seeded onto nutrient agar medium plates, followed by incubation at 37°C for 24-48 hours. Plates with discrete pigmented colonies were considered and morphological characteristics of colonies were recorded. Total 9 morphologically dissimilar discrete bacterial colonies were pulled out and streaked on nutrient agar medium plate to obtain pure cultures. The isolated pure cultures were further maintained on nutrient agar slants at 4°C.

Evaluation of pigment-production at different pH and temperatures
Isolated colonies were streaked on nutrient agar plates with different pH (pH 5, 6, 7 & 8) and incubated at different temperatures ranging from 28°C to 37°C for 24 hrs. Further, the plates were observed for the growth and pigmentation of the isolates.

Extraction of pigments
Bacterial culture grown in nutrient broth with 2% glycerol (pH 7.2) was used for extraction of pigment. The pigments were extracted by using the method described by Asker & Ohta (1999)⁹. One ml of the standard inoculum was added into fifty ml broth in two fifty ml Erlenmeyer flask. This was incubated for 24 hrs in water bath with shaking at 37°C. After incubation, the broth was centrifuged at 10000 rpm for 10 min. and supernatant (colorless) was discarded, followed by resuspension of pelleted cells in distilled water for lysing the cells. Extraction of pigment from suspended cell pellet (kept in water bath at 60°C for 20 min.) was carried out using methanol with repeated centrifugation (10,000 rpm for 10 min.) until cell debris turned colourless.

The supernatants containing the diffused pigment were filtered through membrane filter (0.22μm pore diameter) and filtrates were collected in sterilized screw cap-tubes and dried. The visible absorption spectra of pigments were analyzed by UV-Visible spectrophotometer at 400-600nm (between the wavelength of 350-750 nm) as described by Krishna et al. (2008)¹⁰.

Determination of Antibacterial Activity of the Pigments
The following microorganisms were procured from National Collection of Industrial Microorganisms (NCIM), Pune, India: Bacillus cereus (KR078401; NCIM no. 2155), Escherichia coli (KR109284; NCIM 2065), Vibrio cholera (NCIM no. 5316; ATCC 15748), Bacillus subtilis (ATCC 9372; NCIM 2921), Staphylococcus aureus (KR078391; NCIM 5345) and Bacillus megaterium (NCIM no. 2034; NRRL B 1372(1951). The stock cultures were maintained on nutrient agar at 37°C, then sub-cultured in nutrient broth at 37°C, prior to each test.

The antibacterial activity of the different extracted pigments was carried out by agar-cup diffusion method¹¹. The above mentioned test microorganisms were incubated in nutrient broth at 37°C for 24 hrs. The 0.1 ml of culture was inoculated onto nutrient agar plates and 8.0 mm wells were created with the help of sterile cup-borer. To each well different concentration of the pigments were added followed by incubation of plates (in upright position) at 37°C for 24 hrs. Methanol served as negative control. The experiment was done in triplicates and after 24 hrs antibacterial activity was determined by measuring the zone of inhibition in millimetre.

The minimum inhibitory concentration (MIC) values of the pigments (NP5, NP6, NP8 & NP9) were determined using macro-dilution method, against gram positive and gram negative bacterial pathogens: Escherichia coli, Bacillus cereus, Vibrio cholerae, Bacillus subtilis, Staphylococcus aureus and Bacillus megaterium. Different dilutions of the extracted pigments were prepared in methanol. Bacterial suspension of the test organisms were prepared in Mueller-Hinton broth (sterilized). One ml of the dilution was added to each sterilized screw cap tube containing 1ml of compound (pigment) suitably diluted in the sterilized broth medium to make final volume of  two ml. The culture medium devoid of sample (pigment) and other without microorganism served as negative controls. Incubation of all tubes was carried out at 37°C for 24 hrs; followed by analysis at 600nm.

Evaluation of Antioxidant Activity of Pigments
Antioxidant activity of bacterial pigments obtained from NP5, NP6, NP8 & NP9 was determined by DPPH (1,1-diphenyl-picrylhydrazyl) assay, in which 0.05 mM solution of DPPH (in methanol) was used. Two ml of DPPH solution was added to the equal volume of pigment solution  (at concentration of 150mg/ml; prepared in methanol). The methanol served as control. The optical density (O.D.) was measured after 60 min (at room temperature) at 517 nm using ascorbic acid as standard. The higher DPPH free radical scavenging activity was correlated with lower absorbance of the reaction mixture¹². The following formula was used to calculate percentage inhibition of DPPH, suggestive of percentage of scavenging activity of pigment on DPPH radicals:

Inhibition of DPPH % = (Ao – As) x 100 / Ao

Where, ‘Ao’ refers to Absorption of control; ‘As’ refers to Absorption of tested pigment

Cytotoxicity and anti-cancer activity assay of pigments
The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay was used to assess cell viability¹³. In vitro cytotoxicity effects of different pigments were studied using MCF-7 Breast cancer cell line. Briefly, 96 wells cell culture plate 1×10⁴ Cells were seeded with 200µl of DMEM medium with 10% Bovine Fetal Serum followed byincubation of plate at 37°C to get confluent monolayer. Once 80% confluency was arrived, cells were treated with different concentration of pigments NP5 (orange), NP6 (yellow) and NP9 (red) (100 to 1000 µg/ml) respectively and untreated cells were kept as control. Incubation of plate was carried out at 37°C for 24 hrs, followed by cytotoxicity assessment by MTT assay. The MTT was added to all the treatment wells including control and incubation of plate was carried out at 37°C for 4 hrs. Further, the formazan crystals were solubilized by addition of DMSO for 20 min. The cell viability values were recorded in ELISA reader at 570 nm. The cell viability percentage was calculated by following formula:

Cell viability Percentage (%) = (A₅₇₀ of the test) / (A₅₇₀ of the control) × 100

Molecular identification
The selected pigment producing isolate was subjected to genomic DNA isolation and 16srDNA PCR was performed. The forward primer: 5’ AGAGTTTGATCCTGGCTCAG3’ and reverse primer: 5’AAGGAGGTGATCCAGCCGCA3’ were used. The PCR products were then sent for 16srDNA sequencing. The DNA sequences were BLAST from the existence microbial DNA database and Phylogenetic trees were evaluated.